A secretory hexokinase plays an active role in the proliferation of Nosema bombycis

Hexokinase sequence analysis and ORF amplification

The amino acid sequence of NbHK was submitted to SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/) and NCBI (https://www.ncbi.nlm.nih.gov/) for signal peptide and domain predictions. The HK of N. bombycis (GenBank Accession No. EOB11276.1) was amplified from genomic DNA (gDNA) by PCR. The amplification reaction consisted of 30 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 1 min using the forward primer 5′-CGCGGATCCATGATAATTTTCTATTGT-3′, containing a Bam HI restriction site (GGATCC), and the reverse primer 5′-CCGCTCGAGATAAATAATTCGATGTAAAG-3′ containing a Xho I restriction site (CTCGAG). PCR products were recovered (Omega, Norcross, GA, USA), integrated into pET-32 vector (TaKaRa, Kusatsu, Japan), then the recombinant vectors were transformed into Escherichia coli DH5α competent cells. The identified pET-32a-NbHK vector was sequenced by Sangon (Shanghai, China).

Protein expression, purification and polyclonal antibody preparation

The pET-32a-NbHK vector was transformed into E. coli Rosetta for expression. After cultivation in 37 °C, the recombinant bacteria was induced for 20 h at 16 °C with 1 mM IPTG in LB medium. Nickel chelating affinity chromatography (Roche, Basel, Switzerland) was used to purify the target protein fused with hexahistine. BALB/c mice were used to generate antiserum by immunizing with 100 µg recombinant HK protein homogenized with Freund’s adjuvant (V/V=1:1, Sigma-Aldrich, St. Louis, MO, USA) four times. Complete Freund’s adjuvant was used in the first injection, then the incomplete Freund’s adjuvant was used in the following injections. All animal experiments were approved by Laboratory Animals Ethics Review Committee of Southwest University guidelines (Chongqing, China) (Permit Number: SYXK- 2017-0019).

Indirect immunoinfluscent assay

Infected cells and healthy cells were fixed in PBS with 4% paraformaldehyde, then treated with 0.5% Triton X-100 for 10 min at room temperature, blocked with blocking regent (0.5% (v/v) bovine serum albumin and 10% (w/v) goat serum) for 1 h, incubated with 1:500 dilutions of HK-antiserum (mouse) and Nbβ-tubulin polyclonal antibody (rabbit) at 37 °C for 60 min. After washing with PBS three times (5 min each time), Alexa Fluor 488 and 594 (Thermo Fisher, Santa Clara, CA, USA) were used to detect the binding of primary antibodies at room temperature. The nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, Santa Clara, CA, USA) for 10 min. Samples were observed and imaged with Olympus FV1200 (Olympus, Tokyo, Japan).

Protein preparation

Protein of infected cells, mature spores and healthy cells were prepared by the glass-bead breaking method as reported (Geng et al., 2013). The samples with 0.4 g glass beads (212–300 µm), were lysed in RIPA Lysis Buffer (Beyotime, Shanghai, China) containing a protease inhibitor (phenylmethylsulfonyl fluoride), and then crushed for 5 min at 4 °C using a Bioprep-24 Homogenizer (ALLSHENG, Hangzhou, China). The treated samples were centrifuged at 12,000 rpm for 5 min and the supernatant were collected.

Immunoblot analysis

Proteins were separated by sodium dodecyl SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membrane (Roche, Basel, Switzerland). After blocking in blocking buffer (5% (w/v) skim milk, 20 mM Tris–HCl, 150 mM NaCl and 0.05% Tween-20), membrane incubated with an HK-antiserum or Nbβ-tubulin-antiserum (diluted 1:3,000) (Chen et al., 2017), washed, and incubated with HRP-labeled goat anti-mouse IgG (diluted 1:6,000; Sigma, Saint Louis, MI, USA). The bound antibodies were detected by ECL Plus Western Blotting Detection Reagents (Bio-Rad, Richmond, CA, USA). The protein concentrations were detected with BCA Kit (Beyotime, Shanghai, China), and loading quantity of samples were normalized on the basis of Nbβ-tubulin quantity.

Expression of recombinant HK fused with DsRed in BmN

NbHK was cloned using the forward primer 5′-GGGTACCATGATAATTTTCTATTGT CTAC-3′ or 5′-GGTACCTTAATTAAGACATTGGGAAATA-3′ (to remove the signal peptide (ΔSG)), each containing a KpnI restriction site (GGTACC) and the reverse primer 5′-TGACCCTGAGCCTCCATAAATAATTCGATGTAAAG-3′ containing a G₃S₂ linker sequence (GGAGGCTCAGGGTCA). The DsRed, a red fluorescent protein, was cloned used the forward primers 5′-GGAGGCTCAGGGTCAATGGTGCGCTCCTCCAAGAAC-3′ containing a G₃S₂ linker sequence (GGAGGCTCAGGGTCA) and the reverse primer 5′-CCTCGAGGCGGCCGCTACAGGAACAGG-3′ containing a Xho I restriction site (CTCGAG). Then the DsRed was linked to the rHK and rHKΔSG respectively through a G₃S₂ linker peptide by overlapping PCR. Then the overlapping PCR products were integrated into pCR-Blunt II-TOPO vector (Thermo Fisher, Santa Clara, CA, USA), after which the products of linkage were transform into E. coli DH5α. The recombinant pCR-Blunt II-TOPO vector contained the targets fragments, were extracted from E. coli DH5α. The above vectors and pIZ/V5-His (Thermo Fisher, Santa Clara, CA, USA) were digested by KpnI and Xho I (Thermo Fisher, CA, USA). The digested rHK and rHKΔSG fusing with DsRed were integrated into digested pIZ/V5-His, which was induced by T4 DNA ligase (New England Biolabs, MA, USA). Two µg constructed vectors were transiently transfected into BmN cells using X-tremeGENE™ HP DNA Transfection Reagent (Thermo Fisher, Santa Clara, CA, USA). Three days later, the transfected cells nuclei were labeled with Hoechest (Thermo Fisher, Santa Clara, CA, USA). Then the samples were examined by confocal microscopy (Olympus, Tokyo, Japan).

RNA interference (RNAi) fragments synthesis

The sequence of NbHK was submitted to BLOCK-iT™ RNAi Designer (http://rnaidesigner.thermofisher.com/rnaiexpress/design.do). A 352-bp fragment that contain five potential interferential dsRNA fragments was amplified by the primers F-RI-Hexokinase-T7 5′-TAATACGACTCACTATAGGGAGAAGGAATATACTTGTCTGGGA-3′ and R-RI-Hexokinase-T7 5′-TAATACGACTCACTATAGGGAGATTGACAGGTCTCT CAAATGC-3′, each containing the T7 promoters (TAATACGACTCACTATAGGGAGA). The amplified product was used as template to synthesize dsRNA using a RiboMAX Large Scale System-T7 Kit (Promega, Madison, WI, USA). The dsRNA-EGFP, which was used as the mock group, was prepared with the same method by the primers F-RI-EGFP 5′-TAATACGACTCACTATAGGGAGAACGGCAAGCTGACCCTGAA-3′ and R-RI-EGFP 5′-TAATACGACTCACTATAGGGAGATGTTGTAGTTGTACTCCAG-3′, each containing the T7 promoters as well.

DNA and cDNA collection from infected samples

Spores were separated from hemolymph of severely infected silkworm pupae. The spores which were pretreated with 0.1 mol/L KOH, were added to the Sf9-III cells (cell: spores ratio, 1:5) (Kawarabata & Ren, 1984). Infected cells were collected at 1, 3, 5 days post infection (d. p. i) and stored in PBS or TRIzol (Invitrogen, Carlsbad, CA, USA). The newly molted 4th instar silkworm larvae were oral fed with 1 × 10⁷ spores per. Then, the infected silkworms’ midguts were collected and stored in TRIzol at −80 °C immediately. The gDNA of infected Sf9-III cells was extracted using a DNA Extraction Kit (Omega, Norcross, GA, USA), while the cDNA of infected cells and midguts were prepared using Total RNA Kit II (Omega, Norcross, GA, USA) and RT-PCR Kit (Promega, Madison, WI, USA). Samples were taken from three separate experimental, mock and blank groups at each time point.

RNAi of N. bombycis in infected Sf9-III

The Sf9-III (Thermo Fisher, Santa Clara, CA, USA) cells were infected by using the previous method described above. After infection, two µg dsRNAs of NbHK or EGFP were transfected into Sf9-III respectively and then cultured in 6-well plates (Saleh et al., 2016). The samples were collected at 1, 3 and 5 d. p. i.

Cell counting

The cell samples were suspended with one mL culture medium, then 10 µL cell suspensions were mixed with 10 µL trypan blue. Living counting were finished with Countess II FL (Thermo Fisher, Santa Clara, CA, USA).

Real-time quantitative PCR analysis

For transcription detections, one µg RNA was used to conduct reverse transcript PCR. Then, the products were diluted ten times as templates. Quantitative PCR was amplified using Hexokinase-qF 5′-CAAAATGTGATTATTATGGGAGATG-3′ and Hexokinase-qR 5′-CGATGTAAAGTATAAAGGGCTGAT-3′ primers, and reference gene primers SSU-qF 5′-CTGGGGATAGTATGATCGCAAGA-3′ and SSU-qR 5′-CACAGCATCCATTGGAAA CG-3′ (Huang et al., 2018). Quantitative PCR was performed with following program: a pre-denaturation of 95 °C for 2 min, followed by 40 cycles at 95 °C for 10 s and 60 °C for 20 s (LightCycle 96, Roche, Switzerland). Expression of SfHk was detected using the same method with SfHK-qF 5′-TCACTTACATTCAAGATTTACCCAA-3′ and SfHK-qR 5′-CTACGCCAGAACAAGAAAAGC-3′ primers, and reference gene primers SfGAPDH-qF 5′-GGCTGGCGCTGAATACATCGTTGAGTCCAC-3′ and SfGAPDH-qR 5′-TTAGCAACGGGAACACGGAAAGCCATACCAG-3′.

For Nbβ-tubulin copy number detection, one µL (∼200 ng/µL) of the each gDNA samples extracted from the above infected cells was analyzed by qPCR. The 10 µL reaction systems were conducted using the Nbβ-tubulin-qF 5′-AGAACCAGGAACAATGGACG-3′ and Nbβ-tubulin-qR 5′-AGCCCAATTATTACCAGCACC-3′ primers. Real-time PCRs were performed with the above program (LightCycle 96; Roche, Basel, Switzerland). The standard template had been constructed in previous research (Huang et al., 2018). The standard curve covered four orders of magnitude for the starting quantity (1.3 × 10³–10⁶). The multiple T tests were conducted with GraphPad.Prism.v6.01.

Recombinant hexokinase purification and immunoblot analysis

The amino acid sequence analysis showed that NbHK contained a signal peptide, which implied it was a secretory protein (Fig. 1A). The ORF of HK was cloned by PCR using specific primers based on the gDNA of N. bombycis. The target gene were successfully integrated into pET-32a vector, which was validated by PCR and restriction enzyme digestion (Fig. 1B). The sequencing results showed a 1,287-bp fragment encoding 428 amino acids, which was consistent with the data from the genomic sequence of N. bombycis in SilkPathDB (https://silkpathdb.swu.edu.cn/) (Fig. S1).

SDS-PAGE analysis showed that rHK was expressed at a molecular mass of ∼60 kDa, which was consistent with the predicted size (Fig. 1C). The purified protein was used to prepare the antibody. The titer of the HK antiserum was determined by ELISA (Fig. S2). Western blot indicated that the HK antiserum can recognize a 50 kDa protein specifically in the infected cells proteins, but the signal was not demonstrated in mature spores and healthy Sf9-III cells. (Fig. 1D). The molecular mass difference between rHK and native HK, which was consist in infected cells, was due to tag proteins.

Subcellular localization of NbHK

The subcellular localization of NbHK was analyzed by IFA. Nbβ-tubulin was used as a marker protein to distinguish the meront stage from mature spores. Meronts can be labeled using the Nbβ-tubulin antibody, while the mature spores can be observed visibly in differential-interference microscopy (DIC) (Chen et al., 2017; Huang et al., 2018). The IFA demonstrated the NbHK can be secreted into host cells (Fig. 2). In the proliferation stage, NbHK was located in the nucleus and cytoplasm of host cell (Figs. 2A–2E). When N. bombycis matured, the NbHK tended to be concentrated in the nuclei of host cells (Figs. 2F–2J). The change in localization implied that NbHK’s functions might be different, depending on the growth stage of N. bombycis. The antibody of NbHK cannot bind to host cell in uninfected cells (Fig. S3).

The vectors that encode fusion proteins HK::DsRed and HKΔSG::DsRed were independently transfected into BmN cells (Fig. 3A). The fluorescence signal showed that rHK was localized in the cytoplasm of healthy cells, independent of presence of its signal peptide (Figs. 3B, 3C). When the BmN cells’ nuclei became diffuse, indicating a trend toward apoptosis, the HK::DsRed co-localized with the nuclei (Fig. 3B, white arrow). The similar results were demonstrated in transfected Sf9-III cells (Fig. S4).

Transcriptional profile of NbHK in infected cells and midguts

In infected Sf9-III cells, NbHK was expressed at the early stage of infection and showed a highly significant increase from 8 to 48 h post infection (h. p. i). Then, transcription levels were relatively stayed stable from 48 to 72 h.p.i and were slightly down-regulated from 72 to 96 h.p.i (Fig. 4A). In infected midgut of B. mori, the NbHK expression pattern was similar to that of infected cells. NbHK was gradually up-regulated, except for a slight down-regulation at 24 h. p. i (Fig. 4B). The transcript profile of NbHK implied it functioned during all proliferation stages of N. bombycis.

Down-regulation of NbHK suppressed N. bombycis’ proliferation

The effects of RNAi were assessed using qPCR and western blot. Transcriptional levels revealed that the expression of NbHK was significantly down-regulated by dsRNA in the experimental groups (dsRNA-HK) compared with the mock groups (dsRNA-EGFP) at three and five d.p.i (Fig. 5A). Besides, the western blot also showed NbHK down-regulated at three d.p.i, which was basically consistent with transcriptional detection result (Fig. 5B).

The copy number of Nbβ-tubulin which lacks homology in the host was used to the reflect the infection level of the two groups (Huang et al., 2018). The infection of level the two groups kept similar at 1 d.p.i, because the effect of RNAi was not obvious at this time. In the mock groups, N. bombycis began to proliferate from one to five d.p.i while the proliferation of N. bombycis was remarkably inhibited in the experimental groups at three d.p.i (Fig. 5C).

The dsRNA-EGFP, dsRNA-HK and transfection have no effect on proliferation of host cells and expression of SfHK (Figs, S5A, SB). Besides, the RNAi constructs have no impact on proliferation of N. bombycis (Fig. S6).