The CLEC3B inhibits cellular proliferation and metastasis of cholangiocarcinoma through Wnt/β-catenin pathway

Identification of the CLEC3B gene

The expression level of C-type lectin family genes was analyzed by using the TCGA database (GEPIA (Gene Expression Profiling Interactive Analysis) (cancer-pku.cn)), and the survival of differentially expressed genes was analyzed by Kaplan–Meier analysis with data from NODE database (Ling et al., 2023). The GEPIA visualization tool was used to screen the survival genes of CCA patients in the TCGA database according to the median expression level of each gene. The genes with survival significance in CCA patients were introduced into the CCA clinical cohort for survival analysis, and CLEC3B with survival significance was finally identified (Survival analysis of data from https://www.biosino.org/node/project/detail/OEP001105 statistics, deleted some incomplete data information).

CCA tissue samples and ethics statement

Thirty patients were diagnosed with CCA at the Affiliated Hospital of Qingdao University were included in the study, and the 30 samples included cancerous and para-cancerous tissues. The surgically resected tissues were cut to 0.2 cm*0.2 cm*0.2 cm and stored in a cryostorage tube containing RNA protective solution in a −80 °C refrigerator, or the tissues were cut into 1 cm³ and soaked in 4% paraformaldehyde solution and stored in a cool place at room temperature. This study was approved by the Ethics Committee of the Affiliated Hospital of Qingdao University, and all patients were fully informed and signed written informed consent (Ethics approval number: QYFY WZLL 28817).

Quantitative real-time PCR analysis

At room temperature, RNA was extracted from cells and tissues using Trizol solution, and the concentration was determined. The addition of 1 µg of template RNA and 4 times the concentration of gDNA wiper MIX to the Ep tube was carried out at 42 °C for 2 min to remove gDNA from the mixture. A total of 4 µL 5 ×HiScript III qRT SuperMix was added into the EP tube, mixed and centrifuged. The mixture was placed in a PCR instrument and the cDNA library was constructed under the following reaction conditions: 37 °C (15 min) → 85 °C (5 s) →4 °C(+ ∞). Dilute primer to 0.1OD for use (GAPDH pre-primer sequence: TGACTTCAACAGCGACACCCA, GAPDH post-primer sequence: CACCCTGTTGCTGTAGCCAAA, CLEC3B pre-primer sequence: AGCTCAAGAGCCGTCTGGACAC, CLEC3B post-primer sequence: GGAAGGTCTTCGTCTGGGTGAA). The premixed reaction system (19 µL/ well) and template cDNA (1 µL/well) were added into the eight-row reaction tube and detected by machine according to the reaction conditions provided in the instructions. The experiment made three secondary holes.

Cell lines and cell culture

Biliary duct cancer cell lines QBC939 and HUCCT1 were derived from the Shanghai Cell Bank of the Chinese Academy of Sciences. In brief, bile duct cancer cells were cultured in DMEM (Hyclone, Utah, USA) containing 10% fetal bovine serum and in a 5% CO₂ incubator at 37 °C.

Cell transfection and lentiviral transduction

CLEC3B siRNA and plasmid were purchased from Jima (Shanghai, China) and Jikai (Shanghai, China), respectively. Sequence of CLECL3B-HOM-185: sense (5′–3′): AGAUGUUUGAGGAGCUCAATT, antisense (5′–3′): UUGAGCUCCUCAAACAUCUTT. CLEC3B siRNA was transfected into cells with Xfect™ RNA transfection reagent (Takara, Shiga, Japan). The plasmid was transfected with Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). When the cell density is 60–80%, the siRNA or plasmid is transferred into the cell. QBC939 and HUCCT1 cells were infected with concentrated virus and cultured in complete culture medium containing serum and basic antibiotics for 24 h, and then screened with purinomycin to form stable cell lines. Overexpression of CLEC3B protocol: Cells in 10 cm dishes were cultured to 60%–70% and transfection began. 21 ug negative control plasmid (DNA),42 ul P3000 (transfection reagent) and 500ul serum-free high glucose medium (DMEM) were added to tube A (ep tube), 21 ug CLEC3B plasmid, 42 ul P3000 and 500 ul DMEM were added to tube B. Then 65 ul Lif3000 (transfer agent) and 500 ul DMEM were added to the two ep tubes respectively. The reagents were gently mixed and left for 10 min. The plasmids mixed with transfection reagents were added into cell culture dishes for 24 h–48 h to complete transfection.

Cell viability and colony formation assay

Cell viability was determined using CCK-8 kit (Dojindo Labs, Kumamoto, Japan). Cells were transfected with CLEC3B siRNA or plasmid and inoculated into 96-well plates 24 h later. After cell adhesion, cell activity at different time points was detected using Live Cell Counting Kit 8 (CCK8). Each well was added with 10 µL CCK-8 reagent and 100 ul DMEM and incubated at 37 °C and 5%CO₂ for 2 h. Then absorbance optical density (OD) was measured at 450nm using a multifunctional enzyme marker. The transfected cells were inoculated on a 6-well plate (1,000 cells/well) and cultured for 14days for colony formation test. The cells were first fixed with paraformaldehyde, then stained with crystal violet, and finally, the number of cell colonies in the 6-well plate was counted to determine colony formation capacity.

Wound healing assays

The six-well cell culture plate was used for cell inoculation and cultured at 37 °C, 5% CO₂. Transient transfection was performed after 24 h, and then cultured for 24 h. The cells were gently rinsed with sterile phosphate-buffered saline (PBS) to remove impurities such as cell debris and cultured with pure DMEM without fetal bovine serum. Then use the tip of a 200 µL straw to make a cross scratch at the bottom of the hole. Use a microscope (Nikon, Toyko, Japan) to capture images after 0 h and 24 h. ImageJ software (NIH, Bethesda, MD, USA) was used to measure the wound healing area and calculate the activity.

Invasion and migration assays

The invasion experiment was conducted in the 24-well Millicell chamber. Bile duct cancer cells were transfected and cultured at 37 °C for 24 h. Cells were suspended with DMEM of fetal bovine serum. After microscopic counting, cells with 200 µL serum-free medium (1.0 × 105) were added to the upper chamber (cell), and 600 µL DMEM containing 10% fetal bovine serum was added to the lower chamber (bottom of the pore plate) as a chemical attractant. The chamber was placed in the plate hole and the cell penetration was observed with a microscope. Remove the chamber and soak in methanol for 10 min to fix. The methanol is then poured out and soaked in 0.1% crystal violet solution for 30 min to stain. Finally, the cells were washed with water, the remaining crystal violet on the intima was wiped with a cotton swab, and the migrating cells were quantified at three random fields. The migration experiment was similar to the above, but without the Matrigel coating.

Vertebrate animal study methods

A total of 10 nude mice were purchased from Jinan Pengyue Experimental Animal Breeding Co., LTD. The strain is BALB/C NUDE, SPF grade. These animals were kept in the animal room of the Medical Animal Laboratory Center of the Affiliated Hospital of Qingdao University. Each cage has an independent ventilation system to ensure that no other bacteria interfere with the growth environment of nude mice. The nude mice were anesthetized with lidocaine, and then the nude mice were given subcutaneous injection of bile duct cancer cells (control group and overexpressed CLEC3B group) to make tumors. The size of the tumor was measured after it formed. After deep anesthesia, we de-necked the nude mice and killed them. There were no surviving animals at the end of the experiment.

Xenograft tumor formation model

The QBC939 stable transmutation cells overexpressing CLEC3B (1 × 10⁶) and control QBC939 cells (1 × 10⁶) were injected under the skin of 10 4-week-old male BALB/c thymus free nude mice (purchased from Jinan Pengyue Experimental Animal Breeding Co., LTD.). Within the next month, the nude mice were kept in a disease-free environment and the tumor volume was measured (the calculation formula: Volume (mm3) = length* width* height). After 30 days, the tumor was removed, the final volume was calculated, and the tumor tissue was preserved. This experiment was approved by the Animal Ethics Committee of the Affiliated Hospital of Qingdao University, and all experiments on nude mice were conducted in the pathogen-free medical animal laboratory of the Affiliated Hospital of Qingdao University (Ethics review number: AHQU-MAL20210210).

Western blotting

Total proteins were extracted from transfected cells and tissues in a ratio of 100:1:1 using a lysate consisting of RIPA buffer, phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor mixture (PIC). The Enhanced BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China) was used for quantitative analysis. An equal amount of total protein (30 µg) was electrophoretically transferred to a polyvinylidene fluoride (PVDF) membrane activated with methanol (0.45 µm; Millipore, Burlington, MA, USA). The protein was stained with labeled antibody (mouse or rabbit antibody) and the protein bands were detected by chemiluminescence kit (Affinity, San Francisco, CA, USA).

Statistical analysis

Statistical analysis was carried out with R language and GraphPad. The t test was used to compare the two sets of numerical continuous variables. Chi-square test was carried out for categorical variables. Log-rank checks survival analysis. P < 0.05 was statistically significant.

The CLEC3B was decreased in cholangiocarcinoma

To study the role and mechanism of C-type lectin family proteins in cholangiocarcinoma, we analyzed the expression of the C-type lectin family genes in the TCGA database. Eight of the 12 genes, CLEC1B, CLEC2B, CLEC2D, CLEC3B, CLEC4G, CLEC4M, CLEC7A and CLEC11A, were differentially expressed in cholangiocarcinoma. Four of them were decreased in tumor tissues (Fig. 1A). Then Kaplan–Meier analysis was performed to screened out the genes related to overall survival (OS) in the NODE database. Only the CLEC2B, CLEC3B and CLEC11A showed statistical significance with survival rate. Overall survival was most strongly associated with high expression of CLEC3B, CLEC3b was selected for further study to explore the potential inhibitors that could be used as therapeutic target (Fig. 1B). The expression of cle3b protein was verified in four pairs of fresh tissues, and it was confirmed that the expression of CLEC3B was decreased in the tissues of cholangiocarcinoma (Fig. 1C).

The expression of CLEC3B mRNA in 30 pairs of cholangiocarcinoma tissues was analyzed in CCA tumor tissue and para-cancerous bile duct tissues. The expression of CLEC3B mRNA in tumor tissue significantly decreased in paracancer bile duct tissue (Fig. 1D). According to Kaplan–Meier data analysis, high expression of CLEC3B is associated with better patient outcomes (Fig. 1E). According to the analysis of clinicopathological factors, the expression level of CLEC3B was closely related to TNM stage and lymph node metastasis (Table 1).

CLEC3B inhibits the proliferation of CCA cells in vitro

The QBC939 and HUCCT1 cell lines were overexpressed, or knockdown with CLEC3B plasmid or si-RNA, respectively. The expression efficiency was verified by western blot. The overexpression of CLEC3B could significantly inhibit the proliferation of bile duct cancer cells as indicated by CCK-8 assay and colony formation. The knockdown of CLEC3B resulted in promotion of cellular proliferation (Figs. 2A–2D). The Cyclin D1 and C-myc were decreased with overexpressing CLEC3B, and up-regulated knockdown of CLEC3B (Fig. 2E). Moreover, after regulating the expression of CLEC3B, the BAX and Bcl-2 expression was also changed (Fig. 2F), suggesting that CLEC3B inhibits cellular proliferation and promoted cellular apoptosis.

The CLEC3B inhibits cell migration and invasion of bile duct cancer

To assess the effect of CLEC3B on the ability of cancer cells to migrate, wound healing and transwell experiments were performed. The cell mobility rate of overexpressed CLEC3B cells was significantly lower than that of control cells, while it was increased while knocking down the CLEC3B. The ability of overexpression of CLEC3B to significantly inhibit cell migration and invasion has been confirmed in transwell experiment, while knocking down CLEC3B can enhance the migration and invasion of cancer cells. These results suggest that the migration and invasion of bile duct cancer cells are negatively regulated by CLEC3B (Figs. 3A–3D). CLEC3B increased the expression of E-cadherin and decreased the expression of N-cadherin. The results show that CLEC3B affects EMT process (Fig. 3E).

The Ca²⁺ promotes the biological function of CLEC3B

The CLEC3B as a member of the C-type lectin superfamily, is a kind of transmembrane Ca²⁺ binding protein, we then confirmed whether Ca²⁺ affects the biological function of CLEC3B. Therefore, CaCl₂ was added to complete culture medium of QBC939 and HUCCT1 that overexpressed CLEC3B to a final concentration of 0.8mmol/L. The proliferation ability of bile duct cancer cells was further inhibited after adding Ca ²⁺on the basis of overexpression of CLEC3B. The results of clonal formation were consistent with the above experiments. Transwell’s migration experiments showed that the migration ability was more significantly inhibited after Ca²⁺ addition. The CLEC3B may exert its biological effects depending on the presence of Ca²⁺ (Figs. 4A–4D).

CLEC3B regulates cell proliferation and metastasis through Wnt/β-Catenin signaling pathway

To reveal the CLEC3B-mediated gene regulatory network of CCA, we used RNA sequencing to analyze the transcriptional difference of QBC939 cells after CLEC3B overexpression. Compared with the control cells, the expression of 279 genes was up-regulated and 153 genes were down-regulated (p < 0.01) (Fig. 5A). KEGG analysis showed that signal transduction and tumor progression were significantly associated with these genes, including Wnt signaling pathway (Fig. 5B). After overexpressing CLEC3B in QBC939 and HUCCT1 cells, p-GSK3 β and β-catenin were decreased. These results indicated that, CLEC3B may regulates cell function through the Wnt/ β-catenin signaling pathway (Fig. 5B).

The CLEC3B inhibits tumor formation in vivo

The role of cle3b in vivo was studied by subcutaneous xenograft model. The QBC939 overexpressing CLEC3B were used to construct an overexpression stable cell line. The CLEC3B overexpression stable cell line was inoculated subcutaneously of nude mice. The tumor volume was significantly smaller in the CLEC3B overexpressing group, indicating that CLEC3B can significantly inhibit the tumorigenesis of CCA cells (Fig. 6A). Immunohistochemical staining indicated Ki-67 and N-cadherin were lower in CLEC3B overexpressing group, while E-cadherin was higher in the control group (Fig. 6B). The protein expression was validated by western blot (Fig. 6C). It suggests that CLEC3B inhibit the tumor formation in vivo.