Carbapenemase genes in clinical and environmental isolates of Acinetobacter spp. from Quito, Ecuador

Nicole Sotomayor; José Eduardo Villacis; Noela Burneo; Jorge Reyes; Sonia Zapata; Rosa de los Ángeles Bayas-Rea

doi:10.7717/peerj.17199

Carbapenemase genes in clinical and environmental isolates of Acinetobacter spp. from Quito, Ecuador

Nicole Sotomayor¹, José Eduardo Villacis^2,3, Noela Burneo¹, Jorge Reyes⁴, Sonia Zapata⁵, Rosa de los Ángeles Bayas-Rea ^1,5

Published April 25, 2024

Author and article information

Abstract

Carbapenem-resistant Acinetobacter spp. is associated with nosocomial infections in intensive care unit patients, resulting in high mortality. Although Acinetobacter spp. represent a serious public health problem worldwide, there are a few studies related to the presence of carbapenemases in health care facilities and other environmental settings in Ecuador. The main aim of this study was to characterize the carbapenem-resistant Acinetobacter spp. isolates obtained from four hospitals (52) and from five rivers (27) close to Quito. We used the disc diffusion and EDTA sinergy tests to determine the antimicrobial susceptibility and the production of metallo β-lactamases, respectively. We carried out a multiplex PCR of gyrB gene and the sequencing of partial rpoB gene to bacterial species identification. We performed molecular screening of nine carbapenem-resistant genes (bla_SPM, bla_SIM, bla_GIM, bla_GES, bla_OXA-23, bla_OXA-24, bla_OXA-51, bla_OXA-58, and bla_OXA-143) by multiplex PCR, followed by identification using sequencing of bla_OXA genes. Our findings showed that carbapenem-resistant A. baumannii were the main species found in health care facilities and rivers. Most of the clinical isolates came from respiratory tract samples and harbored bla_OXA-23, bla_OXA-366, bla_OXA-72, bla_OXA-65, bla_OXA-70, and bla_OXA-143-like genes. The river isolates harbored only the bla_OXA-51 and probably bla_OXA-259 genes. We concluded that the most predominant type of carbapenem genes among isolates were both bla_OXA-23 and bla_OXA-65 among A. baumannii clinical isolates.

Cite this as

Sotomayor N, Villacis JE, Burneo N, Reyes J, Zapata S, Bayas-Rea RdlÁ. 2024. Carbapenemase genes in clinical and environmental isolates of Acinetobacter spp. from Quito, Ecuador. PeerJ 12:e17199 https://doi.org/10.7717/peerj.17199

Main article text

Introduction

Acinetobacter species are aerobic, Gram-negative pleomorphic, and non-lactose fermenting bacilli (Murray, Rosenthal & Pfaller, 2021) and they are ubiquitous in nature, including human skin (Almasaudi, 2016). In the past two decades, multidrug-resistant Acinetobacter spp. have become an important cause of health care-associated infections (HAIs), contributing to increase mortality rates in intensive care units (ICUs) (Castanheira, Mendes & Gales, 2023). Of the all Acinetobacter species, A. baumannii is predominant in clinical settings (Evans, Hamouda & Amyes, 2013; Silva et al., 2022) although non-baumannii species are also considered clinically important (Al Atrouni et al., 2016a). The World Health Organization (2017) elevated A. baumannii to the top of the list of critical pathogens. In Ecuador, A. baumannii was the main bacterium associated with HAIs in the ICU in 2010 and 2011 (Jiménez, 2013).

Acinetobacter species have high carbapenem resistance by the acquisition of genetic determinants of resistance through horizontal gene transfer (Castanheira, Mendes & Gales, 2023). The environment plays a key role in the spread of resistance to clinically relevant antibiotics (Singer et al., 2016); the spread of antibiotic resistance genes in river systems is a potential threat to public health (Wang et al., 2018). Environmental strains harbor antibiotic resistance mechanisms, serving as reservoirs for resistant elements and some of them could cause HAIs (Finley et al., 2013; Al Atrouni et al., 2016a). Horizontal gene transfer plays an important role in the transmission antibiotic resistance between non-pathogens and human pathogens (Wang et al., 2018). Worldwide, A. baumannii has increased the carbapenem resistance in around 90% in the last decade (Rosenthal et al., 2021). In Latin America, Acinetobacter spp. resistance to imipenem and meropenem varied from 8% to 89% (Pan American Health Organization, 2021). In 2010, Ecuador reported that 54% of A. baumannii strains were resistant to meropenem and 51% to imipenem (Labarca et al., 2016); however, the percentage of carbapenem resistant increased to 70% according to the Antimicrobial Resistance Surveillance Network of Ecuador (Satán et al., 2023).

The main mechanism of carbapenem resistance in Acinetobacter species is the production of serin-β-lactamases and metallo-β-lactamases enzymes (Castanheira, Mendes & Gales, 2023). In South America, the most common enzymes are oxacillinases (OXA) encoded by bla_OXA-23, bla_OXA-72, bla_OXA-51, bla_OXA-58, bla_OXA-235, and bla_OXA-143 genes (Escandón-Vargas et al., 2017; García-Betancur et al., 2021). There is scarce information about carbapenem-resistant strains from clinical and environmental settings in Ecuador. In the country, studies reported the presence of bla_NDM-1, bla_OXA-23, and bla_OXA-72 genes in A. baumannii clinical isolates (Nuñez et al., 2016; Villacís et al., 2019). Thus, the main aim of this study was to determine the presence of carbapenem-resistant clinical and river Acinetobacter spp.

Materials and Methods

Clinical isolates

The National Reference Laboratory for Antimicrobial Resistance provided us a total of 52 Acinetobacter spp. clinical isolates recovered through the surveillance network from January to December 2015. As part of the standard procedure, the Reference Laboratory get back the Acinetobacter isolates from four different hospitals: Hospital Pediátrico Baca Ortiz (H1, n = 42), Hospital Pablo Arturo Suárez (H2, n = 5), Hospital del Sur Enrique Garcés (H3, n = 3), and Hospital San Francisco de Quito (H4, n = 2) in Quito (Fig. 1). The Reference Laboratory isolated Acinetobacter spp. from the following clinical samples: pleural fluid, cerebrospinal fluid, blood, urine, catheters, secretions, wounds, skin, abscesses, sputum, tracheal aspirates, and unidentified samples recovered from eleven units (ICU, general surgery, traumatology, burn unit, external consultation, neonatal unit, infectious diseases, pediatric unit, internal medicine, emergency, cardiology, and unidentified units). The data from each isolate are detailed in Table S1. The Reference Laboratory previously identified all isolates as A. baumannii based on VITEK 2 compact system® (Biomerieux, Marcy-I’Étoile, France).

Figure 1: Map of the city of Quito showing sampling locations.
*Acinetobacter* spp. clinical isolates recovered through the surveillance network from four hospitals in Quito. The hospitals’ localizations are represented by diamond (H1), square (H2), star (H3), and triangle (H4). The river sampling sites are represented by the circles, which indicates the GPS points where we collected the water sample. Rosa de los Ángeles Bayas-Rea made this map.

Download full-size image

DOI: 10.7717/peerj.17199/fig-1

We inoculated the frozen clinical isolates in sheep blood and MacConkey agars and incubated at 37 °C for 24 h. We used Gram staining, oxidase test, and catalase test to re-confirmed the identity of the isolates. We performed DNA extraction by boiling according to the protocol described by Cuaical et al. (2012); briefly, we boiled an overnight culture diluted in sterile water (500 μl) at 100 °C for 15 min, following centrifugation at 10,000 g for 2 min. We quantified the supernatant by spectrophotometry using the Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA) and stored at −20 °C for subsequent amplification. We confirmed species identification by the amplification of partial RNA polymerase β (rpoB) gene and DNA gyrase subunit B (gyrB) gene according to La Scola et al. (2006) and Higgins et al. (2007, 2010a), respectively. The primers selected are detailed in Table 1.

Table 1:

Primers used in this study for the identification of Acinetobacter spp. and detection of carbapenem-resistant genes.

Target gene	Sequence primer	Size (bp)	References
gyrB	Sp2F: GTTCTTGATCCGAAATTCTCG	490	Higgins et al. (2007)
	Sp4R: AACGGAGCTTGTCAGGGTTA	490
	Sp4F: CACGCCGTAAGAGTGCATTA	294
	Sp4R: AACGGAGCTTGTCAGGGTTA	294
	Sp1F: GACAACAGTTATAAGGTTTCAGGTG	428	Higgins et al. (2010a)
	Sp1R: CCGCTATCTGTATCCGCAGTA	428
	Sp3F: GATAACAGCTATAAAGTTTCAGGTGGT	194
	Sp3R: CAAAAACGTACAGTTGTACCACTGC	194
rpoB	Ac696F: TAYCGYAAAGAYTTGAAAGAAG	350	La Scola et al. (2006)
	Ac1093R: CMACACCYTTGTTMCCRTG	350
	Ac1055F: GTGATAARATGGCBGGTCGT	450
	Ac1598R: CGBGCRTGCATYTTGTCRT	450
bla_SIM	F: TACAAGGGATTCGGCATCG	570	Ellington et al. (2007)
bla_SIM	R: TAAGGCCTGTTCCCATGTG	570	Ellington et al. (2007)
bla_GES	F: ATGCGCTTCATTCACGCAC	863	Opazo et al. (2012)
bla_GES	R: AACTCATCCTGAGCACGGAC	863	Opazo et al. (2012)
bla_SPM	F: AAAATCTGGGTACGCAAACG	271	Ellington et al. (2007)
bla_SPM	R: ACATTATCCGCTGGAACAGG	271	Ellington et al. (2007)
Bla_GIM	F: TCGACACACCTTGGTCTGAA	477	Ellington et al. (2007)
Bla_GIM	R: AACTTCCAACTTTGCCATGC	477	Ellington et al. (2007)
bla_OXA-23	F: GATCGGATTGGAGAACCAGA	501	Woodford et al. (2006)
bla_OXA-23	R: ATTTCTGACCGCATTTCCAT	501	Woodford et al. (2006)
bla_OXA-24	F: GGTTAGTTGGCCCCCTTAAA	246	Woodford et al. (2006)
bla_OXA-24	R: AGTTGAGCGAAAAGGGGATT	246	Woodford et al. (2006)
bla_OXA-51	F: TAATGCTTTGATCGGCCTTG	353	Woodford et al. (2006)
bla_OXA-51	R: TGGATTGCACTTCATCTTGG	353	Woodford et al. (2006)
bla_OXA-58	F: AAGTATTGGGGCTTGTGCTG	599	Woodford et al. (2006)
bla_OXA-58	R: CCCCTCTGCGCTCTACATAC	599	Woodford et al. (2006)
bla_OXA-143	F: TTCTGTCAGTGCATGCTCATC	728	Opazo-Capurro (2014)
bla_OXA-143	R: CAGGCATTCCTTGCTTCATT	728	Opazo-Capurro (2014)
bla_OXA-51	F: CTTATAAGTCATATGAACATTAAAGC	975	Heritier, Poirel & Nordmann (2006)
bla_OXA-51	R: CTCTATAAAAAGGGATCCGGGCTA	975	Heritier, Poirel & Nordmann (2006)
bla_OXA-24	F: ATGAAAAAATTTATACTTCCTA TATTCAGC	825	Jeon et al. (2005)
bla_OXA-24	R: TTAAATGATTCCAAGATTTTCTAGC	825	Jeon et al. (2005)
bla_OXA-23	F: GATGTGTCATAGTATTCGTCG	1,058	Afzal-Shah, Woodford & Livermore (2001)
bla_OXA-23	R: TCACAACAACTAAAAGCACTG	1,058	Afzal-Shah, Woodford & Livermore (2001)

DOI: 10.7717/peerj.17199/table-1

Note:

The primer name, the sequences of primer forward and reverse, the expected size, and reference where the sequences were obtained.

River water collection and bacterial identification

We collected the water samples from five principal rivers: Monjas (MO, n = 6), Machángara (MA, n = 6), San Pedro (S, n = 6), Pita (P, n = 6), and Guayllabamba (G, n = 3) in March and April 2016 (Fig. 1 and Table S1). We chose those rivers for two reasons: (i) the four rivers are the main ones that run through Quito, all of them flow into the Guayllabamba River, and (ii) sewage is released into the city’s rivers without prior treatment. In addition, we chose the number of water collection points based on the accessibility and proximity to the urban center. We collected 100 ml of water samples at each river point and transported to the laboratory with ice packs according to Zhang et al. (2013) with few modifications. Subsequently, we centrifuged the water samples at 1,000 g for 10 min at room temperature, resuspended the pellets with 5 ml of fluid thioglycollate medium, and incubated at 37 °C overnight. We inoculated thirty microliters of cultured sample onto CHROMagar Acinetobacter plates with antimicrobial selective supplement (CR 202; CHROMagar Company, Paris, France) and incubated at 37 °C overnight. We selected all colonies with red pigmentation and identified through morphological and conventional biochemical tests used for the clinical isolates. We identified the positive potential isolates using VITEK-2 compact system® (Biomerieux, Marcy-I’Étoile, France). We confirmed the species identification by the amplification of DNA gyrase subunit B (gyrB) gene according to Higgins et al. (2007, 2010a).

Antimicrobial susceptibility test

We use the disc diffusion method and the EDTA sinergy test to determinate the antimicrobial susceptibility and the production of metallo β-lactamases of clinical and river Acinetobacter spp. isolates (Clinical Laboratory Standards Institute, 2022). We spread a concentration corresponding to 0.5 of the McFarland scale of each isolate on Muller Hinton agar plates and incubated at 37 °C overnight. We included the following eleven antimicrobial susceptibility test discs (OXOID, Waltham, MA, USA): ampicillin/sulbactam (20 μg), ceftazidime (30 μg), ciprofloxacin (10 μg), imipenem (10 μg), meropenem (10 μg), gentamicin (10 μg), amikacin (30 μg), cefepime (30 μg), trimethoprim/sulfamethoxazole (25 μg), piperacillin/tazobactam (110 μg), and tobramycin (30 μg). We interpreted the resistance based on the susceptibility breakpoints of the Clinical Laboratory Standards Institute (2022). To assess the synergistic inhibition, we included an ethylenediaminetetraacetic (EDTA) disc (5 mg) with two carbapenem discs, imipenem (10 mg) and meropenem (10 mg), located at 2 cm from the center of the EDTA disc.

Molecular identification of carbapenems-resistant genes

We performed two different multiplex PCRs to screen the presence of carbapenems-resistant genes including six genes encoding enzymes type serine β-lactamases (bla_GES, bla_OXA-23, bla_OXA-24, bla_OXA-51, bla_OXA-58, and bla_OXA-143) and three genes encoding metallo-β-lactamases (bla_SPM, bla_SIM, and bla_GIM) using specific primers previously described (Ellington et al., 2007; Woodford et al., 2006) (Table 1). We achieved a PCR amplification in a final volume of 25 μl containing 1X of Master Mix Green GoTaq® (12.5 μl) (Promega, Madison, WI, USA), 10 μM of forward and reverse primers (0.5 μl), and 50 ng DNA (1 μl). To each PCR assay, we put positive, internal, and negative controls. Both multiplex PCR reaction conditions are detailed in Table 2. We identified all PCR products through electrophoresis in a 2% agarose gel stained with GelstarTM Nucleic Acid Gel Stain 10000 X staining (Lonza, Rockland, ME, USA) and visualized using Gel Doc XR system (Bio-Rad, Hercules, CA, USA).

Table 2:

Single and multiplex PCR reaction conditions.

Carbapenemase class	Gene	Thermal cycling conditions					Reference
		Initial denaturation	35 cycles			Final extention
		Initial denaturation	Denaturation	Annealing	Extention	Final extention
Multiplex PCR 1	bla_SPM	94 °C for 5 min	94 °C for 30 s	52.8 °C for 40 s	72 °C for 50 s	72 °C for 10 min	Ellington et al. (2007)
	bla_GES
	bla_SIM
	bla_GIM
Multiplex PCR 2	bla_OXA-23	94 °C for 5 min	94 °C for 30 s	53 °C for 30 s	72 °C for 30	72 °C for 10 min	Woodford et al. (2006)
	bla_OXA-24
	bla_OXA-51
	bla_OXA-58
	bla_OXA-143
Sequencing	bla_OXA-51	94 °C for 2 min	94 °C for 1 min	52 °C for 30 s	72 °C for 1 min	72 °C for 10 min	Heritier, Poirel & Nordmann (2006)
	bla_OXA-23	94 °C for 5 min	94 °C for 30 s	52 °C for 40 s	72 °C for 50 s	72 °C for 10 min	Afzal-Shah, Woodford & Livermore (2001)
	bla_OXA-24	94 °C for 5 min	94 °C for 30 s	50 °C for 45 s	72 °C for 1 min	72 °C for 10 min	Jeon et al. (2005)
	bla_OXA-143	94 °C for 5 min	94 °C for 30 s	53 °C for 30 s	72 °C for 30	72 °C for 10 min	Woodford et al. (2006)

DOI: 10.7717/peerj.17199/table-2

Note:

The different thermal cycling conditions for various molecular analyses in this study.

We performed a conventional PCR to amplified the entire sequence of the following genes bla_OXA-23, bla_OXA-24, bla_OXA-51, and bla_OXA-143 genes using primers previously reported (Heritier, Poirel & Nordmann, 2006; Afzal-Shah, Woodford & Livermore, 2001; Jeon et al., 2005; Woodford et al., 2006) (Table 1), following the conditions detailed in Table 2. We cleaned the PCR products using exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT®). We send both DNA strands of all positive bla_OXA genes for sequencing to Macrogen (Seoul, Korea). We aligned manually both forward and reverse sequences for editing and cleaning to obtain a single consensus sequence with the Clustal W program implemented in the MEGA 7 software (Kumar, Stecher & Tamura, 2016). We performed the identification of sequences obtained using a basic local alignment search tool (BLAST) (Altschul et al., 1997). We determined the number of sequences of bla_OXA-51 and bla_OXA-23 genes with DnaSP v.5.10 software (Rozas et al., 2010).

Results

Identification of Acinetobacter spp.

Acinetobacter spp. clinical isolates originated mainly proceeded from pediatric population (77%; 40/52), followed by the adult population (19.2%; 10/52). Isolates derived principally from patients admitted in UCI 32.69% (17/52), followed by unidentified units 15.38% (8/52) and general surgery 13.46% (7/52) (Fig. 2A). According to the clinical specimens, the isolates came from tracheal aspirates 28.85% (15/52), followed by catheters 11.54% (6/52) and abscesses 9.62% (5/52) (Fig. 2B). The majority of clinical isolates were identified as A. baumannii (96.15% 50/52) and A. pittii (3.85%; 2/52) according rpoB gene. Only the identity of A. pittii (3.85%; 2/52) was confirmed with both markers, rpoB and gyrB genes. A. baumannii was found in all type of clinical specimen from all hospital units while A. pittii was found only in tracheal aspirates from UCI. The biochemical and molecular identification of each isolate is detailed in Tables S2 and S3. The nucleotide and amino sequences of partial rpoB gene are detailed in Informations S1 and S2. We submitted all rpoB sequences to GenBank with assigned accession numbers OP796738–OP796781.

Acinetobacter spp. clinical isolates obtained from four hospitals in Quito. — Figure 2: *Acinetobacter* spp. clinical isolates obtained from four hospitals in Quito.
The percentage of *Acinetobacter* spp. clinical isolates. (A) Isolates obtained from different hospital service units. (B) Isolates recovered from clinical specimens.

Download full-size image

DOI: 10.7717/peerj.17199/fig-2

A total of 27 water samples were collected from five rivers. Twenty-two samples presented suggestive Acinetobacter isolates, four samples (RMO3, RS5, RP4, and RG3) showed no growth, and one sample (RMO4) had isolates not related to Acinetobacter spp. We recovered twenty-six suggestive isolates from San Pedro (2), Machángara (4), Pita (1), and Monjas (3) rivers, of which only 38.5% (10/26) were identified as Acinetobacter spp. based on VITEK 2 compact® (Biomerieux, Marcy-I’Étoile, France) and as A. baumannii based on gyrB gene amplification. The remaining corresponded to other genera (Pseudomonas aeruginosa: 34.6%, Stenotrophomonas maltophila: 19.3%, Burkkolderia cepacia: 3.8%, and Moraxella group: 3.8%). The biochemical and molecular identification of each isolate is detailed in Tables S2 and S3.

Phenotypic antimicrobial susceptibility

Clinical isolates presented the higher resistance (100%) to the three antibiotics: imipenem, meropenem, and piperacillin/tazobactam. Forty-eight percent were susceptible to tobramycin (Fig. 3A). The river isolates displayed an antimicrobial profile that varied between resistant and intermediate to eight antibiotics tested. Nevertheless, the main resistance was to piperacillin/tazobactam (100%). All of them were susceptible to tobramycin and ampicillin/sulbactam (100%) (Fig. 3B). According to the synergistic inhibition, both river and clinical isolates did not present metallo-β-lactamases enzymes. The antimicrobial susceptibility profile of the clinical and river isolates is detailed in Table S2.

Figure 3: Clinical and environmental isolates susceptibility profile.

The percentages of clinical isolates that were resistant, intermediate, or sensitive to each antibiotic. (A) Clinical isolates susceptibility profile, (B) river isolates susceptibility profile. Acronyms: CIP, ciprofloxacin; GEN, gentamycin; SXT, trimethoprim/sulfamethoxazole; AMK, amikacin; FEP, cefepime; MEN, meropenem; IMP, imipenem; TOB, tobramycin; SAM, ampicillin/sulbactam; CAZ, ceftazidime; TZP, piperacillin/tazobactam; R, resistant; I, intermediate; S, sensitive.

Molecular identification of carbapenem-resistance genes

According the screening of carbapenem-resistance genes, clinical isolates presented the following genes: bla_SIM, bla_SPM, bla_GES, bla_OXA-23, bla_OXA-24, bla_OXA-51, and bla_OXA-143; whereas, seven river isolates showed bla_OXA-51 gene (Table S3). The bla_SIM gene, co-harbored with the bla_OXA-72 and bla_OXA-143 genes, was the least frequently detected (1.9%; 1/52; 15-1175) in A. pittii. The bla_SPM gene, co-harbored with the bla_OXA-51 and bla_OXA-23 genes, was detected in 13.46% (7/52; 15-0122, 15-0591, 15-690, 15-780, 15-795, 15-853, 15-1,138) in A. baumannii. The bla_GES gene, co-harbored with the bla_OXA-51, bla_OXA-23, bla_OXA-72, bla_OXA-143, and bla_SIM genes was present in 11.53% (6/52) in A. baumannii (15-0669, 15-690, 15-853, 15-900) and A. pittii (15-691, 15-1,175). The bla_OXA-23 gene, co-harbored with the bla_OXA-51 gene, was found in 98.07% (51/52) present in A. baumannii. The bla_OXA-24 gene, co-harbored with both bla_OXA-23 and bla_OXA-51 genes, was present in 9.6% (5/52) in A. baumannii (15-0659, 15-0985, 15-1064, and 15-1367) and in A. pittii (15-0691). The bla_OXA-143 gene was the least frequently detected (1.9%; 1/52; 15-1,175); this gene was co-harbored with the bla_OXA-24 gene in A. pittii.

Carbapenem-resistance genes sequences analysis

We reported 47 bla_OXA-51 sequences: 42 complete sequences of 813 bp and five partial sequences of 340 bp from A. baumannii clinical isolates. Of bla_OXA-51 sequences, we identified two genes encoding OXA-65 (n = 44), OXA-70 (n = 2) and one unidentified (MF594746). Forty complete sequences (MF594725–MF594728, MF594730–MF594737, MF594735, MF594739, MF594741–MF594745, OP554146–OP554168) and four partial sequences (MF594729, MF594734, MF594736, and MF594737) shared 100% of nucleotide identity with bla_OXA-65 of A. baumannii (GenBank accession number CP033869.1); whereas two entire sequences (MF594740 and MF594747) shared 100% nucleotide identity with bla_OXA-70 of A. baumannii (GenBank accession number NG_049811.1).

We found 48 bla_OXA-23 sequences: 42 complete sequences of 820 bp and six partial sequences of 471 bp from A. baumannii clinical isolates. Of bla_OXA-23 sequences, we identified two genes encoding OXA-23 (n = 38) and OXA-366 (n = 10). Thirty-two entire sequences (MF594756–MF594759, MF594762–MF594767, MF594769, MF594772–MF594777, OP554169, OP554170, OP554172–OP554178, OP554180–OP554182, OP554185–OP554187, OP554189, OP554191–OP554193) and six partial sequences (MF594755, MF594760, MF594761, MF594768, MF594770, and MF594771) shared 100% of nucleotide identity with bla_OXA-23 of A. baumannii (GenBank accession number CP110468.1). Ten complete sequences (MF594757, MF59474–MF59476, OP554171, OP554179, OP554183, OP554184, OP554188, and OP554190) shared 100% nucleotide identity with bla_OXA-366 of A. baumannii (GenBank accession number NG_049659.1).

We reported five bla_OXA-24/40 entire sequences of 817 bp (MF594778, MF594779, MF594781, MF594782, and MF594783) and one partial sequence of 204 bp (MF594780). Of bla_OXA-24/40 sequences, we identified one gene encoding OXA-72 present in three A. baumannii and two A. pitti clinical isolates that shared 100% of nucleotide identity with bla_OXA-72 of A. baumannii (GenBank accession number MN495626) and also A. pittii (GenBank accession number MN481287.1).

Sequencing of the bla_OXA-143 PCR product obtained from A. pitti clinical isolates identified gene encoding OXA-499. Our bla_OXA-143 sequence (MF594724) shared 99% nucleotide and amino acid identity with bla_OXA-499 of A. pittii (GenBank accession numbers NG_049775.1 and ALM96709.1). The nucleotide sequence presented one specific change in nucleotide 280, first position of the codon (GTG) (ATG), resulting in a valine (V) to methionine (M) change in position 94 (Fig. 4).

Figure 4: Alignment of OXA-143 amino acid sequences.
The polymorphic sites at the amino acid sequence level. The identity of the sequences was compared to the OXA-143 variant (GenBank protein number access WP_063861042.1 or its nucleic number access NG_049441.1). Numbers in the heading row indicate the base pair position of the polymorphic sites. Dots (.) show the identity with the Aba OXA-143. Acronyms: Aba, *Acinetobacter baumannii*; Api, *A. pittii*.

Download full-size image

DOI: 10.7717/peerj.17199/fig-4

Sequencing of the bla_OXA-51 PCR products obtained from A. baumannii river isolates identified two genes encoding OXA-65 and OXA-259. Four partial sequences (MF594748–MF594751) from three rivers (Pita, Machángara, and San Pedro) shared 100% of nucleotide identity with bla_OXA-65 of A. baumannii (GenBank accession number OL961415.1) and three partial sequences (MF594752–MF594754) from Machángara River shared 100% of nucleotide identity with bla_OXA-259 of A. baumannii (GenBank accession number CP053098.1).

The nucleotide and amino sequences of bla_OXA genes are detailed in the Informations S3 to S10. We submitted all sequences to GenBank with assigned accession numbers MF594724–MF594783, OP554146–OP554193.

Discussion

Acinetobacter spp. in clinical and river isolates

Our findings indicated that Acinetobacter baumannii is the most common species found in clinical isolates from tracheal aspirates from ICU. Similarly, studies reported high rates of baumannii species in ICU samples elsewhere (Qin et al., 2021; Bakhshi et al., 2022). Previous Ecuadorian studies reported high percentages of A. baumannii from respiratory tract samples, bronchial secretions, or tracheal aspirates (Jiménez, 2013; Nuñez et al., 2016; Villacís et al., 2019). On the other hand, we found A. baumannii in the most polluted river environments, Machángara and Monjas rivers (Yungán, 2010; Roldós, 2015). Similar, some studies found these bacteria in river water as well as sewage water (Hrenovic et al., 2016; Kisková et al., 2023). Pathogens of clinical origin as A. baumannii can reach aquatic environments as a result of different human activities, such as sewage water discharge directly into the river without pretreatment (Silva et al., 2016). Acinetobacter spp. survive in wastewater contributing to the spread clinical antibiotic resistance genes in aquatic systems (Kisková et al., 2023; Tobin et al., 2024). Particularly, hospital sewage water is considered a major source of multidrug-resistant pathogenic bacteria and antibiotic residues (Zhang et al., 2013). Contrary, we did not isolate any Acinetobacter spp. from the Guayllabamba River probably due to the distance (2 km), the collection points were far away from the wastewater reservoirs of urban areas and the bacterial concentrations decreases and distribution changes (Zhang et al., 2009).

Carbapenem-resistant Acinetobacter spp.

In our study, the clinical and environmental Acinetobacter isolates showed different susceptibility profiles. Clinical isolates exhibited a high rate of resistance to imipenem and meropenem; while, river isolates displayed a low resistance only to imipenem. In general, clinical isolates have high resistance to both antibiotics (Cortivo et al., 2015). The percentage of resistance found in this study was higher compared with an Ecuadorian study (Jiménez, 2013). River isolates are usually more sensitive compared to clinical isolates. The difference in the patterns of resistance found can be due to various factors such as, biological conditions, virulence factors, epidemiology, or place of origin (Karmostaj, Najar & Salmanian, 2013). In general, it is expected that the antibiotic concentration is lower in aquatic environments than in clinical environments (Zhang et al., 2009; Zhang et al., 2013). In clinical environments, antibiotics (in particular broad-spectrum antibiotics) are supplied continuously, promoting selective pressure in clinical isolates. Following this, the transmission of genetic determinants among clinical isolates could take place through horizontal gene transfer (Zhang et al., 2009; Castanheira, Mendes & Gales, 2023). Nonetheless, the possibility of clonal dissemination as a mean of increasing antibiotic resistance, should not be discarded. This situation generates a faster antibiotic resistance evolution in clinical isolates than in environmental isolates (Zhang et al., 2013). However, the susceptibility results of environmental samples should be treated with caution, as these profiles were based on clinical standards (CLSI) and a small sample size (n = 10).

Carbapenemases genes in Acinetobacter spp.

The high percentage of carbapenem-resistance found in clinical isolates may be increased due to the presence of bla_OXA-51, bla_OXA-23, bla_OXA-72, and bla_OXA-143 genes. According to some studies, the association of bla_OXA-23 and bla_OXA-51 genes as the main cause for carbapenem resistance (i.e., Martínez & Mattar, 2012; Teixeira et al., 2013; Cortivo et al., 2015). The bla_OXA-72 gene increases its resistance activity in the presence of imipenem and ampicillin/sulbactam (Kuo et al., 2013). The bla_OXA-143 and bla_OXA-72 genes in association with intrinsic mechanisms as the alteration of the of the outer membrane proteins promotes a high resistance to meropenem (Mostachio et al., 2012; Sen & Joshi, 2015). The low percentage of carbapenem-resistance found in environmental isolates may be explained by the absence of bla_OXA genes. It is necessary the presence of insertion elements to promote overexpression of the bla_OXA-51 gene since this gene it generates a weak resistance (Higgins, Zander & Seifert, 2013; Teixeira et al., 2013; Sen & Joshi, 2015). The bla_OXA-51 overexpression would be linked to the resistance to imipenem in A. baumannii river isolates (Martínez & Mattar, 2012; Evans, Hamouda & Amyes, 2013). It would be important to know about possible ISAba1 insertions upstream of the gene or alternative genes conferring resistance in the five isolates with resistance phenotype.

We found a high percentage of bla_OXA-23 and bla_OXA-51 genes in A. baumannii and A. pittii clinical isolates. The high percentage of bla_OXA-23 gene found in A. baumannii, is related to its distribution worldwide since a single sequence was found in the study. The bla_OXA-23 gene distribution has been associated with a clonal spread (Higgins et al., 2010b; Labarca et al., 2016). In the other hand, bla_OXA-51 gene has been reported principally in baumannii species (Lee et al., 2012; Teixeira et al., 2013; Périchon et al., 2014). Since bla_OXA-51 gene can be found in the chromosome (Poirel, Naas & Nordmann, 2010), some authors consider it as an intrinsic marker for A. baumannii identification (Higgins et al., 2010b; Périchon et al., 2014). However, the gene may be in transposons and plasmids (Liu et al., 2015; Wang et al., 2015; Sennati et al., 2016). Its dissemination among other Acinetobacter species from different environments is possible, suggesting that the dissemination may not be by clonal strains (See Labarca et al., 2016).

Our findings detected two different bla_OXA-51 variants OXA-65 and OXA-70 were circulating in the four hospitals; while, in rivers probably are OXA-65 and OXA-259, suggesting that the genes were under selective pressure. Similarly, previous studies OXA-65 was reported in A. baumannii clone ST79 from Guayaquil (Rodríguez et al., 2016). In Latin America, is one of the variants found in A. baumannii in Brazil, Argentina, Paraguay, Mexico, and Honduras (Rodríguez et al., 2016; Nodari et al., 2020; Graña-Miraglia et al., 2020). There is not report about the presence of OXA-70 neither OXA-259 variant in South America. The information about OXA-70 variant is scare worldwide. OXA-70 has been reported in Hong Kong, Malaysia, Ghana, and Honduras (Alattraqchi et al., 2020; Ayibieke et al., 2020; Brown & Amyes, 2005; Galac et al., 2020). OXA-70 belong to the most diverse collection of class D carbapenemases, subgroup 3 that is the major mechanism of carbapenem resistance in A. baumannii (Brown & Amyes, 2005). OXA-259 variant has been reported in A. baumannii clinical isolates from China, Tanzania, and Thailand (Jia et al., 2019; Moyo et al., 2021; Chukamnerd et al., 2022) as well in bulk tank milk in Germani (Sykes et al., 2023). The variant OXA-259 is located on the chromosome of A. baumannii and constitute an intrinsic oxacillinase genes with low-level carbapenemase activity that naturally occur (Chukamnerd et al., 2022), due there is a not ISA_balike elements (Fedrigo et al., 2022). To the best of our knowledge, this is the first report of the OXA-70 and OXA-259 in A. baumannii in Ecuador.

Our findings showed the presence of bla_OXA-366 gene in both species A. baumannii and A. pittii clinical isolates from Ecuador. The information about this variant is scare. GenBank previously reported a sequence of bla_OXA-366 in A. baumannii from USA. Whereas the OXA-366 variant has been reported also in A. baumannii clinical isolates in Iran (Bahador et al., 2015). To the best of our knowledge, this is the first report of the OXA-366 in A. baumannii and A. pittii in South America.

The bla_OXA-72 gene co-harbored with bla_OXA-23 and bla_OXA-51 genes was identified in low levels in A. baumannii and A. pittii. This variant was documented previously in A. baumannii clinical isolates from Guayaquil (Nuñez et al., 2016; Rodríguez et al., 2016) and from neighboring countries Colombia, Peru, and Brazil (Saavedra et al., 2014; Saavedra et al., 2017; Werneck et al., 2011; de Sá Cavalcanti et al., 2013; Levy-Blitchtein et al., 2018; Nodari et al., 2020) and in A. pittii from Colombia (Montealegre et al., 2012), Brazil (Brasiliense et al., 2019), European and Asian countries (Al Atrouni et al., 2016b; Bonnin et al., 2014). The presence of this gene in two species may be due to the bla_OXA-72 gene spreads through horizontal gene transfer mediated by plasmids (Montealegre et al., 2012; Kuo et al., 2013; Nuñez et al., 2016; Rodríguez et al., 2016). To the best of our knowledge, this is the first report of the bla_OXA-72 gene in A. pittii in Ecuador.

This is also the first report of the bla_OXA-143 gene in A. pittii clinical isolates from Ecuador. In South America, this gene and its variants (OXA-231, OXA-253, and OXA-255) have been reported in A. baumannii clinical isolates in Brazil (Higgins et al., 2009; Gionco et al., 2012; Girlich et al., 2014), Perú (Levy-Blitchtein et al., 2018), and Colombia (Saavedra et al., 2017). The variant found in this study is very different from OXA-143 variants reported in A. baumannii from Brazil, Honduras, and Korea (Higgins et al., 2009; Zander et al., 2014; Kim et al., 2010). Interestingly, the sequence alignment showed a high similarity between our variant with two OXA-143 variants (OXA-499 and OXA-255) described to A. pittii in Korea (D’Souza et al., 2017) and United States (Zander et al., 2014). In particular, the difference between the variant reported in this study differs by a change in amino acid sequence with OXA-499 reported by D’Souza et al. (2017). To the best of our knowledge, this is the first report of a variant similar to OXA-499 in A. pittii in South America.

Conclusions

Overall, our results showed that the most of the Acinetobacter spp. clinical isolates came from tracheal aspirates from ICU. Our findings showed that carbapenem-resistant A. baumannii were the main species found in the study. We reported the presence of bla_OXA-65, bla_OXA-70, bla_OXA-72, bla_OXA-23, bla_OXA-366, and bla_OXA143-carrying multidrug-resistant genes in baumannii and no baumannii species. We report a new possible variant of OXA-143 circling in different hospitals in Quito and the possible presence of OXA-259 in aquatic environment. The presence of A. baumannii in the rivers increases the concern, since the resistance can be disseminated, polluting water sources, and promoting community acquired outbreaks.

To our knowledge, this is the first study that has characterized the carbapenemases genes in Acinetobacter spp. carbapenem-resistant isolates from four hospitals and five rivers in Quito. No bla_OXA-65, bla_OXA-70, bla_OXA-72, bla_OXA-23, bla_OXA-366, or bla_OXA143-carrying multidrug-resistant baumanii and no baumannii species have been described in Quito so far.

Supplemental Information

Clinical and River isolates data.

All samples correspond to Zone 9, which represents the code for Quito. The table details the hospital code, INSPI isolate code, geographical coordinates age, sex, sample type, and hospital unit of the patients to which each sample corresponds. In addition, the table indicated the river data, id code, geographical coordinates, and river name. Acronyms: NA: not available.

DOI: 10.7717/peerj.17199/supp-1

Download

Biochemical results and antibiotic susceptibility profile of Acinetobacter spp.

NA: Not applied, Aba: A. baumannii, Aha: A. haemolyticus, ABC: A. baumannii/calcoaceticus complex, ng/µl: nanograme/microlitre, Y: yes, N: not. Biochemical results are expressed as positive (+) and negative (−). The antibiotic susceptibility profile are expresed as Intermediate (I), Sensistive (S), and Resistance (R).

DOI: 10.7717/peerj.17199/supp-2

Download

Molecular results of Acinetobacter spp. obtained by amplification and sequencing of different genes.

A. baumannii was identified by the amplification of both products, 490 bp and 294 bp, and A. pittii with a product of 194 bp of gyrB gene. The species identification was corroborate by sequencing on partial rpo gene. PCR results are expressed for carbapenen resistance genes as positive (+) and negative (−). The table details the GenBank number acccess of sequences obtained in this study.

DOI: 10.7717/peerj.17199/supp-3

Download

Additional Information and Declarations

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Nicole Sotomayor performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, water sample collection, and approved the final draft.

José Eduardo Villacis conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Noela Burneo conceived and designed the experiments, performed the experiments, analyzed the data, authored or reviewed drafts of the article, water sample collection, and approved the final draft.

Jorge Reyes conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Sonia Zapata conceived and designed the experiments, authored or reviewed drafts of the article, funding granted by the USFQ necessary for the sequencing of the complete genes bla_OXA-51, bla_OXA-23, and bla_OXA-24, and approved the final draft.

Rosa de los Ángeles Bayas-Rea conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Data Availability

The following information was supplied regarding data availability:

The sequences are available at GenBank: MF594724–MF594783, OP796381.1–OP796781.1, OP554146.1–OP554193.1.

The raw measurements are available in the Supplemental Files.

Funding

This work was supported by the Pontificia Universidad Católica del Ecuador project (No. L13341) and Universidad San Francisco de Quito (COCIBA Grant). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

[1] Afzal-Shah M, Woodford N, Livermore DM. 2001. Characterization of OXA-25, OXA-26, and OXA-27, molecular class D β-lactamases associated with carbapenem resistance in clinical isolates of Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 45(2):583-588

[2] Al Atrouni A, Joly-Guillou ML, Hamze M, Kempf M. 2016a. Reservoirs of non-baumannii Acinetobacter species. Fronteirs in Microbiology 7(49):1-12

[3] Al Atrouni A, Joly-Guillou ML, Hamze M, Kempf M. 2016b. Emergence of NDM-1 and OXA-72 producing Acinetobacter pittii clinical isolates in Lebano. New Microbes and New Infections 12:43-44

[4] Alattraqchi AG, Rahman NIA, Ismail S, Cleary DW, Clarke S, Yeo CC. 2020. Whole genome sequencing of Acinetobacter baumannii hospital isolates from Terengganu, Malaysia: prevalence of the GC2 ST195 clone in 2011–2012. International Journal of Infectious Diseases 101:34

[5] Almasaudi SB. 2016. Acinetobacter spp. as nosocomial pathogens: epidemiology and resistance features. Saudi Journal of Biological Sciences 25(3):586-596

[6] Altschul SF, Madden TL, Shäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25(17):3389-3402

[7] Ayibieke A, Kobayashi A, Suzuki M, Sato W, Mahazu S, Prah I, Mizoguchi M, Moriya K, Hayashi T, Suzuki T, Iwanaga S, Ablordey A, Saito R+3 more. 2020. Prevalence and characterization of carbapenem-hydrolyzing class D β-lactamase-producing Acinetobacter isolates from Ghana. Frontiers in Microbiology 11:587398

[8] Bahador A, Raoofian R, Pourakbari B, Taheri M, Hashemizadeh Z, Hashemi FB. 2015. Genotypic and antimicrobial susceptibility of carbapenem-resistant Acinetobacter baumannii: analysis of is aba elements and bla_OXA-23-like genes including a new variant. Frontiers in Microbiology 6:1249

[9] Bakhshi F, Firoozeh F, Badmasti F, Dadashi M, Zibaei M, Khaledi A. 2022. Molecular detection of OXA-type carbapenemases among isolated from burn patients and hospital environments. The Open Microbiology Journal 16(1):1-6

[10] Bonnin RA, Docobo-Pérez F, Poirel L, Villegas MV, Nordmann P. 2014. Emergence of OXA-72-producing Acinetobacter pittii clinical isolates. International Journal of Antimicrobial Agents 43(2):195-196

[11] Brasiliense DM, Lima KVB, Pérez-Chaparro PJ, Mamizuka EM, de Oliveira Souza C, Dutra LMG, McCulloch JA. 2019. Emergence of carbapenem-resistant Acinetobacter pittii carrying the blaOXA-72 gene in the Amazon region. Brazil Diagnostic Microbiology and Infectious Disease 93(1):82-84

[12] Brown S, Amyes SGB. 2005. The sequences of seven class D β-lactamases isolated from carbapenem-resistant Acinetobacter baumannii from four continents. Clinical Microbiology and Infection 11(4):326-329

[13] Castanheira M, Mendes RE, Gales AC. 2023. Global epidemiology and mechanisms of resistance of Acinetobacter baumannii-calcoaceticus complex. Clinical Infectious Diseases 76(Supplement_2):S166-S178

[14] Chukamnerd A, Singkhamanan K, Chongsuvivatwong V, Palittapongarnpim P, Doi Y, Pomwised R, Sakunrang C, Jeenkeawpiam K, Yingkajorn M, Chusri S, Surachat K+1 more. 2022. Whole-genome analysis of carbapenem-resistant Acinetobacter baumannii from clinical isolates in Southern Thailand. Computational and Structural Biotechnology Journal 20(545):558

[15] Clinical Laboratory Standards Institute. 2022. Performance standards for antimicrobial susceptibility testing. Wayne, PA, USA: Clinical and Laboratory Standards Institute.

[16] Cortivo GD, Gutberlet A, Ferreira JA, Ferreira LE, Campos R, Westphal GA, Condeixa PH. 2015. Antimicrobial resistance profiles and oxacillinase genes in carbapenem-resistant Acinetobacter baumannii isolated from hospitalized patients in Santa Catarina, Brazil. Revista da Sociedade Brasileira de Medicina Tropical 48(6):699-705

[17] Cuaical NM, Delgado YA, Anzola YM, Marcano D, Torres L. 2012. Detección de carbapenemasas tipo OXA en aislados de Acinetobacter baumannii de diferentes centros hospitalarios de Caracas, Venezuela. Revista de la Sociedad Venezolana de Microbiología 32(2):95-110

[18] D’Souza R, Pinto NA, Higgins PG, Hwang I, Yong D, Choi J, Lee K, Chong Y. 2017. First report of the carbapenemase gene bla_OXA-499 in Acinetobacter pittii. Antimicrobial Agents and Chemotherapy 61(5):e02676-16

[19] de Sá Cavalcanti F, Soares AC, Vilela MA, de Morais MA, Camargo MM, Leal-Balbino TC. 2013. Emergence of extensively drug-resistant OXA-72-producing Acinetobacter baumannii in Recife, Brazil: risk of clonal dissemination? Diagnostic Microbiology and Infectious Disease 77(3):250-251

[20] Ellington MJ, Kistler J, Livermore DM, Woodford N. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-β-lactamases. Journal of Antimicrobial Chemotherapy 59(2):321-322

[21] Escandón-Vargas K, Reyes S, Gutiérrez S, Villegas MV. 2017. The epidemiology of carbapenemases in Latin America and the Caribbean. Expert Review of Anti-infective Therapy 15(3):277-297

[22] Evans BA, Hamouda A, Amyes SG. 2013. The rise of carbapenem-resistant Acinetobacter baumannii. Current Pharmaceutical Design 19(2):223-238

[23] Fedrigo NH, Xavier DE, Cerdeira L, Fuga B, Marini PVB, Shinohara DR, Carrera- Marroni F, Lincopan N, Tognim MCB. 2022. Genomic insights of Acinetobacter baumannii ST374 reveal wide and increasing resistome and virulome. Infection, Genetics and Evolution 97:105148

[24] Finley RL, Collignon P, Joakim DG, McEwen SA, Li XZ, Gaze WH, Reid-Smith R, Timinouni M, Graham DW, Topp E. 2013. The scourge of antibiotic resistance: the important role of the environment. Clinical Infectious Diseases 57(5):704-710

[25] Galac MR, Snesrud E, Lebreton F, Stam J, Julius M, Ong AC, Maybank R, Jones A, Kwak Y, Hinkle H, Waterman P, Lesho E, Bennett J, Mc Gann P+4 more. 2020. A diverse panel of clinical Acinetobacter baumannii for research and development. Antimicrobial Agents and Chemotherapy 64(10):10-1128

[26] García-Betancur JC, Appel TM, Esparza G, Gales AC, Levy-Hara G, Cornistein W, Vega S, Nuñez D, Cuellar L, Bavestrello L, Castañeda-Méndez P, Villalobos-Vindas J, Villegas MV+3 more. 2021. Update on the epidemiology of carbapenemases in Latin America and the Caribbean. Expert Review of Anti-infective Therapy 19(2):197-213

[27] Gionco B, Pelayo JS, Venancio EJ, Cayô R, Gales AC, Carrara-Marroni FE. 2012. Detection of OXA-231, a new variant of bla_OXA-143 in Acinetobacter baumannii from Brazil: a case report. Journal of Antimicrobial Chemotherapy 67(10):2531-2539

[28] Girlich D, Damaceno QS, Oliveira AC, Nordmann P. 2014. OXA-253, a variant of the carbapenem-hydrolyzing class D β-lactamase OXA-143 in Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 58(5):2976-2978

[29] Graña-Miraglia L, Evans BA, López-Jácome LE, Hernández-Durán M, Colín-Castro CA, Volkow-Fernández P, Cevallos M, Franco-Cendejas R, Castillo-Ramírez S. 2020. Origin of OXA-23 variant OXA-239 from a recently emerged lineage of Acinetobacter baumannii international clone V. Msphere 5(1):e00801-19

[30] Heritier C, Poirel L, Nordmann P. 2006. Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clinical Microbiology and Infection 12(2):123-130

[31] Higgins PG, Dammhayn C, Hackel M, Seifert H. 2010b. Global spread of carbapenem-resistant Acinetobacter baumannii. Journal of Antimicrobial Chemotherapy 65(2):233-238

[32] Higgins PG, Lehmann M, Wisplinghoff H, Seifert H. 2010a. gyrB multiplex PCR to differentiate between Acinetobacter calcoaceticus and Acinetobacter genomic species 3. Journal of Clinical Microbiology 48(12):4592-4594

[33] Higgins PG, Poirel L, Lehmann M, Nordmann P, Seiftert H. 2009. OXA-143, a novel carbapenem-hydrolyzing class D β-lactamase in Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 53(12):5035-5038

[34] Higgins PG, Wisplinghoff H, Krut O, Seifert H. 2007. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clinical Microbiology and Infection 13(12):1199-1201

[35] Higgins PG, Zander E, Seifert H. 2013. Identification of a novel insertion sequence element associated with carbapenem resistance and the development of fluoroquinolone resistance in Acinetobacter radioresistens. Journal of Antimicrobial Chemotherapy 68(3):720-722

[36] Hrenovic J, Goic-Barisic I, Kazazic S, Kovacic A, Ganjto M, Tonkic M. 2016. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014. Eurosurveillance 21(15):1-10

[37] Jeon BC, Jeong SH, Bae IK, Kwon SB, Lee K, Young D, Lee JH, Song JS, Lee SH. 2005. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23 β-lactamase in Korea. Journal of Clinical Microbiology 43(5):2241-2245

[38] Jia H, Sun Q, Ruan Z, Xie X. 2019. Characterization of a small plasmid carrying the carbapenem resistance gene bla_OXA-72 from community-acquired Acinetobacter baumannii sequence type 880 in China. Infection and Drug Resistance 2019(12):1545-1553

[39] Jiménez A. 2013. Vigilancia microbiológica año 2011: una herramienta para el control de las infecciones intrahospitalarias (IIH), área de cuidados intensivos (ACI) HCAM. Bachelor Thesis, Universidad San Francisco de Quito, Quito, Ecuador

[40] Karmostaj A, Najar PS, Salmanian AH. 2013. Emergence of Tigecycline resistant Acinetobacter baumannii from an intensive care unit (ICU) in Tehran. Jundishapur Journal of Microbiology 6(3):215-219

[41] Kim CK, Lee Y, Lee H, Woo GJ, Song W, Kim MN, Lee WG, Jeong SH, Lee K, Chong Y. 2010. Prevalence and diversity of carbapenemases among imipenem-nonsusceptible Acinetobacter isolates in Korea: emergence of a novel OXA-182. Diagnostic Microbiology and Infectious Disease 68(4):432-438

[42] Kisková J, Juhás A, Galušková S, Maliničová L, Kolesárová M, Piknová M, Pristaš P. 2023. Antibiotic resistance and genetic variability of Acinetobacter spp. from wastewater treatment plant in Kokšov-Bakša (Košice, Slovakia) Microorganisms 11(4):840

[43] Kumar S, Stecher G, Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 37(7):1870-1874

[44] Kuo SH, Yang SP, Lee YT, Chuang HC, Chen CP, Chang CL, Chen TL, Lu PL, Hsueh PR, Fung CP. 2013. Dissemination of imipenem-resistant Acinetobacter baumannii with new plasmid-borne bla_OXA-72 in Taiwan. BMC Infectious Diseases 13:319

[45] La Scola B, Gundi VA, Khamis A, Raoult D. 2006. Sequencing of the rpoB gene and flanking spacers for molecular identification of Acinetobacter species. Journal of Clinical Microbiology 44(3):827-832

[46] Labarca JA, Costa MJ, Seas C, Guzmán-Blanco M. 2016. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in the nosocomial setting in Latin America. Critical Reviews in Microbiology 42(2):276-292

[47] Lee Y, Kuo S, Chiang M, Yang S, Chen C, Chen T, Fung C. 2012. Emergence of carbapenem-resistant non-baumannii species of Acinetobacter harboring a bla_OXA-51-like gene that is intrinsic to A. baumannii. Antimicrobial Agents and Chemotherapy 56(2):1124-1127

[48] Levy-Blitchtein S, Roca I, Plasencia-Rebata S, Vicente-Taboada W, Velásquez-Pomar J, Muñoz L, Moreno-Morales J, Pons M, Valle-Mendoza J, Vila J. 2018. Emergence and spread of carbapenem-resistant Acinetobacter baumannii international clones II and III in Lima, Peru. Emerging Microbes & Infections 7(1):1-9

[49] Liu LL, Ji SJ, Ruan Z, Fu Y, Fu YQ, Wang YF, Yu YS. 2015. Dissemination of bla_OXA-23 in Acinetobacter spp. in China: main roles of conjugative plasmid pAZJ221 and transposon Tn2009. Antimicrobial Agents and Chemotherapy 59(4):1998-2005

[50] Martínez P, Mattar S. 2012. Imipenem-resistant Acinetobacter baumannii carrying the ISAba1-bla_{OXA-23, 51} and ISAba1-bla_ADC-7 genes in Monteria, Colombia. Brazilian Journal of Microbiology 43(4):1274-1280

[51] Montealegre MC, Maya JJ, Correa A, Espinal P, Mojica MF, Ruiz SJ, Rosso F, Vila J, Quinn JP, Villegas MV. 2012. First identification of OXA-72 carbapenemase from Acinetobacter pittii in Colombia. Antimicrobial Agents and Chemotherapy 56(7):3996-3998

[52] Mostachio AK, Levin AS, Rizek C, Rossi F, Zerbini J, Figueiredo S. 2012. High prevalence of OXA-143 and alteration of outer membrane proteins in carbapenem-resistant Acinetobacter spp. isolates in Brazil. International Journal of Antimicrobial Agents 9(5):396-401

[53] Moyo SJ, Manyahi J, Hubbard AT, Byrne RL, Masoud NS, Aboud S, Manji K, Blomberg B, Langeland N, Roberts AP. 2021. Molecular characterization of the first New Delhi metallo-β-lactamase 1-producing Acinetobacter baumannii from Tanzania. Transactions of The Royal Society of Tropical Medicine and Hygiene 115(9):1080-1085

[54] Murray P, Rosenthal K, Pfaller M. 2021. Microbiología Médica (9a Edition). Barcelona: Elsevier.

[55] Nodari CS, Cayô R, Streling AP, Lei F, Wille J, Almeida MS, Inacio de Paula A, Campos A, Seifert H, Higgins P, Gales AC+1 more. 2020. Genomic analysis of carbapenem-resistant Acinetobacter baumannii isolates belonging to major endemic clones in South America. Frontiers in Microbiology 11:584603

[56] Nuñez T, Rodríguez CH, Castro G, Nastro M, Balderrama N, Dabos L, Acosta Y, Plaza N, Famiglietti A. 2016. Outbreak of bla_OXA-72-producing Acinetobacter baumannii in South America. Journal of Chemotherapy 13(5):1-4

[57] Opazo A, Sonnevend A, Lopes B, Hamouda A, Ghazawi A, Pal T, Amyes S. 2012. Plasmid-encoded PER-7 β-lactamase responsible for ceftazidime resistance in Acinetobacter baumannii isolated in the United Arab Emirates. Journal of Antimicrobial Chemotherapy 67(7):1619-1622

[58] Opazo-Capurro A. 2014. Mobilome and antibiotic resistance in Acinetobacter baumannii. Doctoral Thesis, University of Edinburgh, Edinburgh, Scotland

[59] Pan American Health Organization. 2021. Magnitud y tendencias de la resistencia a los antimicrobianos en Latinoamérica. RELAVRA 2014, 2015, 2016. Informe resumido Organización Panamericana de Salud; 2020 Oct 16. Washington, D.C.: Pan American Health Organization (accessed 28 August 2023)

[60] Périchon B, Goussard S, Walewski V, Krizova L, Cerqueira G, Murphy C, Feldgarden M, Wortman J, Clermont D, Nemec A, Courvalin P+1 more. 2014. Identification of 50 class D β-lactamases and 65 Acinetobacter-derived cephalosporinases in Acinetobacter spp. Antimicrobial Agents and Chemotherapy 58(2):936-949

[61] Poirel L, Naas T, Nordmann P. 2010. Diversity, epidemiology, and genetics of class D β-lactamases. Antimicrobial Agents and Chemotherapy 54(1):24-38

[62] Qin J, Feng Y, Lü X, Zong Z. 2021. Precise species identification for Acinetobacter: a genome-based study with description of two novel Acinetobacter species. mSystems 6(3):722

[63] Rodríguez CH, Balderrama N, Nastro M, Nuñez T, Castro G, Magne R, Ugarte T, Valenzuela N, Roach F, Mota MI, Burger N, Velázquez G, Ortellado-Canese J, Bruni G, Pandolfo C, Bastyas N, Famiglietti A+7 more. 2016. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii in South America. Journal of Medical Microbiology 65(10):1088-1091

[64] Roldós MA. 2015. Planta de tratamiento de aguas residuales en Pomasqui. Bachelor Thesis, Universidad San Francisco de Quito, Quito, Ecuador

[65] Rosenthal VD, Duszynska W, Ider BD, Gurskis V, Al-Ruzzieh MA, Myatra S, Gupta D, Belkebir S, Upadhyay N, Zand F, Kumar S, Kharbanda M, Nair PK, Mishra S, Chaparro G, Zala M, Janc J, Aguirre-Avalos G, Aguilar-De-Morós D, Erben N+10 more. 2021. International nosocomial infection control consortium (INICC) report, data summary of 45 countries for 2013–2018, adult and pediatric units, device-associated module. American Journal of Infection Control 49(10):1267-1274

[66] Rozas J, Librado P, Sánchez-DelBarrio J, Messeguer X, Rozas R. 2010. DnaSP version 5.10.1.

[67] Saavedra SY, Cayô R, Gales AC, Leal AL, Saavedra CH. 2014. Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: a case report. Brazilian Journal of Infectious Diseases 18(6):678-680

[68] Saavedra SY, Prada-Cardozo D, Rincón V, Pérez-Cardona H, Hidalgo AM, González MN, Reguero M, Valenzuela E, Mantilla J, Falquet L, Barrero-Hernández E, Duarte C+2 more. 2017. Whole-genome sequence of a Colombian Acinetobacter baumannii strain, a coproducer of OXA-72 and OXA-255-like carbapenemases. Genome Announcements 5(7):M100

[69] Satán C, Satyanarayana S, Shringarpure K, Mendoza-Ticona A, Palanivel C, Jaramillo K, Villavicencio F, Davtyan H, Esparza G. 2023. Epidemiology of antimicrobial resistance in bacteria isolated from inpatient and outpatient samples, Ecuador, 2018. Revista Panamericana de Salud Pública 47:e14

[70] Sen B, Joshi SG. 2015. Studies on Acinetobacter baumannii involving multiple mechanisms of carbapenem resistance. Journal of Applied Microbiology 120(3):619-629

[71] Sennati S, Villagran AL, Bartoloni A, Rossolini GM, Pallecchi L. 2016. OXA-23-producing ST25 Acinetobacter baumannii: first report in Bolivia. Journal of Global Antimicrobial Resistance 4:70-71

[72] Silva L, Grosso F, Branquinho R, Gonçalves T, Souza C, Peixe L. 2016. Exploring non-hospital-related settings in Angola reveals new Acinetobacter reservoirs for bla_OXA-23 and bla_OXA-58. International Journal of Antimicrobial Agents 48(2):228-230

[73] Silva MCB, Werlang HMB, Vandresen D, Fortes P, Pascotto C, Lúcio L, Ferreto L. 2022. Genetic, antimicrobial resistance profile and mortality rates of Acinetobacter baumannii infection in Brazil: a systematic review. Narra J 2(1):e68

[74] Singer AC, Shaw H, Rhodes V, Hart A. 2016. Review of antimicrobial resistance in the environment and its relevance to environmental regulators. Frontiers in Microbiology 7:1728

[75] Sykes EM, Mateo-Estrada V, Zhanel G, Dettman J, Chapados J, Gerdis S, Akineden Ö, Khan I, Castillo-Ramírez S, Kumar A. 2023. Emergence of ADC-5 Cephalosporinase in environmental Acinetobacter baumannii from a German tank milk with a novel sequence type. Access Microbiology 5(6):47

[76] Teixeira AB, Martins AF, Barin J, Hermes DM, Pitt CP, Barth AL. 2013. First report of carbapenem-resistant Acinetobacter nosocomialis isolates harboring ISAba1-bla_OXA-23 genes in Latin America. Journal of Clinical Microbiology 51(8):2739-2741

[77] Tobin LA, Jarocki VM, Kenyon J, Drigo B, Donner E, Djordjevic SP, Hamidian M. 2024. Genomic analysis of diverse environmental Acinetobacter isolates identifies plasmids, antibiotic resistance genes, and capsular polysaccharides shared with clinical strains. Applied and Environmental Microbiology 7(10):e01654-23

[78] Villacís JE, Bovera M, Romero-Alvarez D, Cornejo F, Albán V, Trueba G, Dorn H, Reyes JA. 2019. NDM-1 carbapenemase in Acinetobacter baumannii sequence type 32 in Ecuador. New Microbes and New Infections 29(12):100526

[79] Wang X, Gu J, Gao H, Qian X, Li H. 2018. Abundances of clinically relevant antibiotic resistance genes and bacterial community diversity in the Weihe River, China. International Journal of Environmental Research and Public Health 15(4):708

[80] Wang D, Yan D, Hou W, Zeng X, Qi Y, Chen J. 2015. Characterization of bla_OXA-23 gene regions in isolates of Acinetobacter baumannii. Journal of Microbiology, Immunology and Infection 48(3):284-290

[81] Werneck JS, Picão RC, Carvalhaes CG, Cardoso JP, Gales AC. 2011. OXA-72-producing Acinetobacter baumannii in Brazil: a case report. Journal of Antimicrobial Chemotherapy 66(2):452-454

[82] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SG, Livermore DM. 2006. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. International Journal of Antimicrobial Agents 27(4):351-353

[83] World Health Organization. 2017. Press release. WHO publishes list of bacteria for which new antibiotics are urgently needed. (accessed 6 December 2022)

[84] Yungán J. 2010. Estudio de la calidad de agua en los afluentes de la microcuenca del río blanco para determinar las causas de la degradación y alternativas de manejo. Bachelor Thesis, Escuela Superior Politécnica del Chimborazo