Cadmium nitrate and DNA methylation in gastropods: comparison between ovotestis and hepatopancreas

Experimental design and rearing conditions

All experiments were run at the Laboratory Animal Facility from the “Victor Babes” University of Medicine and Pharmacy, Timisoara. In September 2021, 160 newly-matured specimens of the common brown garden snail, Cornu aspersum, were purchased from the “Mokry Dwor” snail farm (Krzymow wielkopolskie, Poland). Throughout the four-week experimental period, the gastropods were fed ad libitum with Cd-spiked, agar-based diets. Ad libitum feeding implies that experimental animals had these diets available to them all the times; hence were fed without restriction. This type of feeding management is the most often used method for different animal models in dietary exposure experiments for chemicals in food (World Health Organization, 2009).

The fodder was prepared as previously described (Nica et al., 2017a). That is, the control diet was prepared by mixing 50 grams (g) infant cereals (Nestle Nestum 5—Five Cereals), 20 g carrot baby food (HiPP, UK), and 15 g agar (A-1296, Sigma) with double distilled water to obtain 1000 milliliters (mL) agar medium. After adding three milliliters of 1% methylparaben solution to extend the storage period, each liter of medium was divided equally among forty 7-cm-diameter Petri dishes (about 25 mL/dish). These plates were maintained post-cooling in the refrigerator for maximum one week. In the case of Cd-spiked diets, the fodder was prepared in a similar manner, with solutions of different cadmium concentrations being used instead of double distilled water. The eight nominal Cd treatments used to prepare the fodder, that is 0, 0.05, 0.1, 0.2, 1, 5, 10, and 100 milligrams per liter (mg/L), were abbreviated as Cd0, Cd0.05, Cd0.1, Cd0.2, Cd1, Cd5, Cd10, and Cd100. Cadmium nitrate tetrahydrate (Cd(NO₃)₂ 4H₂O, ≥ 99.99% trace metal basis, Sigma-Aldrich) was used as a source of cadmium.

Exposures were conducted in two independent experiments per each treatment group (Replica I and Replica II). Each replica consisted of 10 specimens. For each replicate jar, the snails were maintained in polypropylene containers (50 × 20 × 20 cm) with perforated side walls at 18 to 20 °C, under a constant light-dark cycle of 12:12 h. The bottom of each container was covered with ash-free filter paper sheets (50 × 20 cm), which were wetted twice daily with double distilled water. Food was given daily (two Petri dishes per container). The daily activity schedule involved fodder supply, removal of faeces and uneaten food, replacing the sheet of ash-free filter paper, cleaning the containers with sterile paper towels, and, of particular importance, snail fitness monitoring and dead specimen collection.

Before running experiments, the shell height was measured with a digital caliper to the nearest 0.01 mm (for all snails) as the distance between the suture and the base of expanded lip (Kerney & Cameron, 1979). The most homogeneous four gastropods from each replicate were selected based on this parameter; that is, eight specimens per treatment group (n = 8). These specimens were weighed with an analytical balance to the nearest 0.01 mg in order to provide us with the same level of uniformity among sampling groups in terms of pre-exposure body weight. Their shells were numbered with black acrylic paint to ensure proper identification of each gastropod.

At the end of the experiment, the numbered snails were weighed again to determine the post-exposure body weight. For each experimental group, four gastropods (two specimens per each replicate) were randomly sacrificed to collect hepatopancreas and ovotestis samples for DNA extraction. Results from previous studies lend support to this sample size (n = 4) as being enough for detecting changes in total 5mC content of gastropod DNA (Muller et al., 2016; Sanchez-Arguello et al., 2016; Bal, Kumar & Nugegoda, 2017; Nica et al., 2017a; Georgescu et al., 2021). In addition, such sample sizes are not unusual for exploratory studies aiming to determine trends or patterns of changes (Ko & Lim, 2021), which was the case of our investigation. Moreover, this moderate sample size is often used in (eco)toxicological studies on genome-wide DNA methylation due to budget and time constraints.

Snail fitness

Snail fitness was evaluated based on sublethal and lethal toxicological endpoints. Weight gain/loss and hypometabolism tendency were used as sublethal toxicological endpoints. The former variable was determined as the difference between the snail weight at the beginning and the end of the experiment. The latter variable was defined as the tendency of snails to exhibit reduced metabolic activity (stop/reduce feeding and enter into aestivation). Survival rate was used as a lethal endpoint of exposure.

DNA extraction and 5mC quantification analysis

Genomic DNA was extracted from hepatopancreas and ovotestis with the GenElute™ Mammalian Genomic DNA Miniprep Kit (Merck KGaA, Darmstadt, Germany) as per manufacturer’s instructions. A DS-11 Spectrophotometer (DeNovix, Wilmington, USA) was used to evaluate DNA purity by determining a sample absorbance spectrum at 260 nm and 280 nm, and calculating the A₂₆₀/A₂₈₀ ratio. Genome-wide 5mC levels in DNA samples were assessed using the MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (EpiGentek, East Farmingdale, NY, USA), as previously described (Georgescu et al., 2021). Optical density (OD) was measured at 450 nanometers using a Stat Fax 4200 microplate reader (Awareness Technology, Palm City, FL, USA). For absolute 5-mC quantification, a standard curve was obtained by plotting the various concentrations of the positive controls against the corresponding ODs.

Methyl specific polymerase chain reaction (MSP)

The effect of cadmium (given as cadmium nitrate) on the methylation status of the seven CpG and GpC sites in the 5′-UTR promoter region of the Cd-MT gene in the hepatopancreas of mature C. aspersum specimens was investigated. MSP analysis was run using one forward primer (CdMTbs-F1/ggatttatYGtaggatattaattaagg) and two reverse primers (CdMTbs-R1/ctaaaaataaaaccaaataccaatcctac; CdMTbs-R2/Ccttaccacacttacaaccatc) (Georgescu et al., 2021). The bisulfite-converted DNA was obtained after using the ‘high molarity’ protocol (Genereux et al., 2008). More precisely, 20–25 microliters of DNA were first denatured in 0.3 N sodium hydroxide (NaOH) at 42 °C for 20 min (min). At the same time, bisulfite solution was prepared under a hood by dissolving 2.10 g sodium bisulfite (NaHSO₃) and 0.68 g ammonium sulfite monohydrate ((NH₄)₂SO₃ H₂O) in five mL of 45% NH₄HSO₃ in water (all chemicals from Merck, Darmstadt, Germany) to obtain a final volume of 6.0 mL and a pH of 5.4. Denatured DNA samples were then put into 185 microliters bisulfite solution and maintained at 70 °C for 150 min.

The bisulfite-converted DNA samples and the HotStarTaq Master Mix reagent (Qiagen, Hilden, Germany) were subjected to PCR amplification with the aforementioned primers. For each PCR, 0.25−0.5 micrograms of DNA were used; the reaction volume was 40 microliters. PCR conditions were: denaturation for 15 min at 95 °C; four cycles of denaturing for 30 s (sec) at 94 °C, annealing for 35 s at 54 °C, and elongation for 30 s at 72 °C; then 5 min at 72 °C. To verify for specific amplification by MSP, a 10 microliters aliquot of the PCR product was run on a 1.5% Tris-acetate-EDTA-agarose gel (Merck, Darmstadt, Germany). After agarose gel electrophoresis, the amplicons were visualized by using ethidium bromide staining (Merck, Darmstadt, Germany).

Statistical analysis

First, the homogeneity of different treatment groups with respect to pre-exposure body weight was anayzed. These data sets were verified for normality and homoskedasticity (homogeneity of variance) using Anderson-Darling tests and Bartlett’s tests, respectively. A one-way ANOVA was applied if both these assumptions were met, with post hoc comparisons using the Scheffe’s procedure being applied against the control group in case of significant results. If the data did not meet the aforementioned criteria, a Kruskal-Wallis test with Dunn’s post tests was used.

Next, the effect of dietary cadmium on absolute values for weight gain/loss was determined using a similar approach. After that, the snails were classified into specimens with and without hypometabolic behavior. These data were tabulated as a 8 × 2 contingency table and analyzed using a Chi² goodness of fit test, with tests based on 2 × 2 contingency tables being run against controls in case of significant differences. Finally, snail survival across different treatments was compared using a Log-Rank test. Post hoc comparisons using the Breslow’s procedure were applied versus controls in case of significant results.

The proportion of snails surviving at the end of the experimental period for each treatment was determined using a Kaplan–Meier curve. The mean survival time was calculated as the area under the Kaplan–Meier estimate of the survival curve. The treatment was considered complete for the dead gastropods and censored for the specimens who were still alive at the end of the study.

The genome-wide methylation data sets were transformed by decimal logarithmation and then analyzed in the same manner as the weight-related data. A T test on methylation data for controls was next applied to determine whether there are significant differences between the total 5mC contents in the DNA samples from ovotestis and hepatopancreas. For bisulfite PCR, statistical analysis was performed separately for each of the seven CpGs studied. After being classified into methylated and unmethylated, these data were analyzed in a similar way to data sets for hypometabolism tendency. All statistical analyses were conducted with the Statistica 8 software package (StatSoft Inc., Tulsa, OK, USA) and a two-tailed p value <0.05 was considered significant.

Snail fitness

Mean pre-exposure body weight, the number of snails with hypometabolic behavior, and the mortality-related data for each treatment group are given in Table 1. Data sets for the former variable met the criteria for normality (Anderson-Darling tests, p ≥ 0.327) and homogeneity (Bartlett’s test, p = 0.962). The average weighted pre-exposure body weight for all groups was 8.89 g. The highest values were seen in controls and the lowest values in the Cd10 snails (Table 1). The raw data used to generate these values are given in Table S1. There were no significant inter-group differences in pre-exposure body weight (ANOVA, (F(7, 56) = 1.12, p = 0.361)). These results validate our experimental assumption, i.e., the gastropods selected for this study were of uniform body weight.

Weight gain/loss at the end of the experiment ranged from −0.43 g in the Cd100 gastropods up to 2.64 g in the Cd0.1 specimens, as seen in Fig. 1. The overall weighted mean for all groups was 1.80 g. The raw data used to create this figure are displayed in the Table S1. These data sets were normally distributed (Anderson-Darling tests, p ≥ 0.209) and homoskedastic (Bartlett’s test, p = 0.122).

Cadmium exerted a significant impact on weight gain (ANOVA, (F(7, 56) = 21.74, p < 0.001)). Specimens from the lowest four treatment groups showed similar weight gains compared to controls (Fig. 1). There was a trend of decrease in body weight gain starting from the third highest dose onward (Fig. 1). However, significant differences occurred only for gastropods receiving the highest cadmium dose (Cd100); that is, a significant 5% decrease in body weight (Fig. 1).

Three weeks after starting the experiment, a part of gastropods from the three highest treatment groups tended to reduce/cease feeding and/or enter into aestivation as cadmium dose increased (see Table 1). The proportion of snails with hypometabolism tendency differed significantly between groups (Chi² test, df = 7, p < 0.001). Post hoc comparisons against controls yielded significant results for the specimens receiving the highest Cd dose (Chi² test, df = 1, p < 0.001), but not for the other treatment groups (Chi² tests, df = 1, p ≥ 0.073).

No mortalities occurred in controls, as well as for the numbered snails. Low death rates were found for cadmium-exposed specimens (see Table 1). In addition, no significant inter-group differences were observed in temporal distribution of death after cadmium exposure (Log-Rank test, p = 0.927). The raw data used to conduct this analysis are given in the Table S2.

Genome-wide DNA methylation levels

Log₁₀-transformed data for total 5mC levels in DNA of the hepatopancreas and ovotestis are shown in Figs. 2 and 3, respectively. The corresponding absolute values are given in Table S3. The mean values in hepatopancreas ranged from 0.27% in specimens exposed to the second lowest Cd dose (Cd0.1) up to 0.88% in snails fed the highest cadmium dose (Cd100), with an overall weighted mean for all groups of 0.38% (Fig. 2). The average ovotestis 5mC content varied between 0.42% in gastropods from the second lowest treatment group (Cd0.1) and 0.94% in specimens from the highest treatment group (Cd100). The corresponding overall weighted mean for all groups was 0.62% (Fig. 3).

All data sets met the assumptions of normality (Anderson-Darling tests, p ≥ 0.273) and homogeneity of variance (Bartlett’s, p ≥ 129). Significant changes occurred in genomic DNA methylation levels in snail hepatopancreas (ANOVA, (F(7, 31) = 4.47, p = 0.002)), but not in snail ovotestis (ANOVA, (F(7, 31) = 0.13, p = 0.162)). Post hoc testing revealed a significant hypermethylation of hepatopancreas DNA for snails exposed to the highest Cd dose (Cd100). In contrast no effect was seen for the other treatments (Fig. 2).

There was no evident dose–response pattern with respect to the 5mC content of ovotestis DNA (Fig. 3). However, the total DNA methylation levels in the ovotestis of controls were significantly greater than the values measured in the hepatopancreas (T test, p = 0.023). This trend was also observed in Cd-exposed snails (Figs. 2 and 3). The mean variance (for pooled methylation data sets) in ovotestis was almost three-fold higher than that seen for the hepatopancreas (0.13 vs 0.5).

Cd-MT gene promoter methylation

For all treatment groups, all cytosines from the seven analyzed CG base pairs were converted to thymines after bisulfite treatment and PCR amplification, irrespective of the primer pairs used and organ analyzed. Cadmium dose had no significant effect on their methylation status (Chi² test, df = 7, p = 1). These data suggest that the 5′ region close to the presumed Cd-MT transcription start site is not likely to be constitutively methylated in the hepatopancreatic DNA and ovotestis DNA, and its methylation status is not affected by cadmium exposure.

Snail fitness

Gastropod exposure to cadmium yields adverse effects on multiple fitness endpoints, such as body weight, shell growth, and metabolic activity (Russell, De Haven & Botts, 1981; Laskowski & Hopkin, 1996; Gomot, 1997; Nica et al., 2015; Nica et al., 2017b). Mature C. aspersum snails were fed diets containing a broad range of Cd concentrations, including the maximum allowable levels in vegetal foods routinely consumed by land snails, such as leafy vegetables or fruits (MWFEP, 2002; European Comission No 1881/2006); and the reference values for hepatopancreatic cytotoxicity and genotoxicity (Hodl et al., 2010). The present study hence provides a realistic perspective of the potential (eco)toxicological implications related to exposure to cadmium nitrate.

Under the present experimental conditions, cadmium given at these environmentally relevant concentrations exerted a significant effect on body weight only in mature snails exposed to very high doses (at least 100 mg/kg d. wt Cd). However, the pattern observed in the dose–response curve indicates that smaller exposure doses may affect body weight for longer exposure durations. It is also possible that the sample size used in this study (n = 8, for body weight) was not large enough to detect statistically significant differences.

Interestingly, the same specimens displayed a significant increase in hypometabolism tendency. However, this exposure event did not adversely affect survival. These findings are in agreement with literature data showing that decrease in body weight, feeding cessation, and entrance to dormancy precedes lethality in Cd-exposed gastropods (Russell, De Haven & Botts, 1981; Laskowski & Hopkin, 1996; Gomot, 1997; Nica et al., 2015). Moreover, this lack of major effects on fitness parameters critical for survival reinforces the utility of this land snail species as invertebrate model for dissecting the pathobiology of sublethal cadmium exposure.

Cadmium effect on gastropod DNA methylation

Generally speaking, genomic DNA methylation levels in the hepatopancreas and ovotestis of C. aspersum are comparable to those quantified via ELISA-based procedures in the whole body, foot, or head of the southern creeper, Zeacumantus subcarinatus (Sowerby, 1855); the acute bladder snail, Physa acuta (Draparnaud, 1805); and the ram’s horn snail, Biomphalaria glabrata (Say, 1818) (Joe, 2013; Muller et al., 2016; Geyer et al., 2017; Aparicio, 2021). The measured values in the hepatopancreas of controls are also consistent with those determined in C. aspersum specimens of similar age and size (Nica et al., 2017a; Georgescu et al., 2021). Taken together, these findings suggest that the global 5mC content in gastropod DNA is likely to exhibit moderate inter-species and inter-organ variation, that is 0.1−4.9% as determined via ELISA (Joe, 2013; Muller et al., 2016; Geyer et al., 2017; Nica et al., 2017a; Aparicio, 2021; Georgescu et al., 2021); and lie at the lower end of the range reported for invertebrates (Srut, 2021).

Congruent with literature data on cadmium sulphate (Georgescu et al., 2021), only specimens given 100 mg/kg d. wt Cd as cadmium nitrate displayed significant hypermethylation of hepatopancreas DNA. In the case of cadmium chloride, this response occurred from doses of 10 mg/kg d. wt Cd onward (Nica et al., 2017a). Different values of acid dissociation constants of these salts may account for these outcomes since there is indication that different anions bound to the same cation within a salt exert distinct DNA methylation changes (Gao et al., 2013).

Global 5mC content of ovotestis DNA was, by contrast, not affected by cadmium uptake via food. This organ retains smaller amounts of cadmium when compared to the hepatopancreas (Vaufleury & Kerhoas, 2000; Nica et al., 2017a; Vukasinovic-Pesic et al., 2020), and thus may exhibit a lower Cd sensitivity. It is also plausible that the higher variability of total 5mC percentage in the former organ is related to the different stages of snail reproductive cycle. For example, gametogenesis is associated with dynamic and continually changing genome-wide DNA-methylation levels required to generate mature sperm and ovocytes (Maamar et al., 2022). With respect to this organ, we also note that the measured values in controls were significantly above those in the hepatopancreas. However, the biological significance of all these findings cannot be precisely established at this stage without confirming these results and additional experimental evidence.

Cytosine methylation in hepatopancreas DNA was absent at the 5′-end of the Cd-MT gene and MSP experiment did not allow us to observe changes in the CpG methylation level in response to oral Cd given as cadmium nitrate. This is in line with previous findings relating to land snails exposed to cadmium sulfate (Georgescu et al., 2021). Similar results were obtained for the ovotestis. Analysis of DNA methylation status in CG pairs of the Cd-inducible metallothionein gene wMT-2 promoter in the common earthworm, Lumbricus terrestris (Linnaeus, 1758), also revealed that these sites are normally unmethylated. This was also valid for Cd-exposed specimens (Drechsel et al., 2017). As a result, one can expect a low likelihood of 5mC to occur at the promoter region of the Cd-MT gene in C. aspersum. In fact, literature data indicate that functional DNA methylation at gene promoters is a rare paradigm among mollusks. To the best of our knowledge, such a mechanism has been reported in gastropods only for the Aplysia sea slugs. That is, a CpG island in the promoter of the CREB2 gene—a key gene in long-term memory formation and persistence—commonly exists in both unmethylated and methylated states and its methylation status is responsive to serotonine exposure (Rajasethupathy et al., 2012). There is also evidence, although again rare, for functional promoter DNA methylation in bivalve mollusks; e.g., methylation of CpG4-6 in promoter region of the gene encoding galectin in the pearl oyster Pinctada fucata (Gould, 1850) (Li et al., 2015).

Relevance of DNA methylation parameters in land snails as toxicological endpoints

To date, toxicological knowledge of cadmium nitrate impact on animals was limited to data derived from enzymatic, cytotoxic, genotoxic, and organismal endpoints (e.g., Ledda-Columbano et al., 1984; Lin et al., 1994; Yamadori et al., 2010). The present findings provide a new perspective on its effects by showing that cadmium nitrate can interfere with epigenetic mechanisms regulating gene expression. This effect is accompanied by changes in other relevant exposure endpoints, such as body weight gain or hypometabolic tendency. Such responses are known to occur in terrestrial gastropods exposed to cadmium, but have never been reported for dietary cadmium given as cadmium nitrate.

Consistent with previous laboratory investigations (Nica et al., 2017a; Georgescu et al., 2021), the total 5mC content in DNA of C. aspersum hepatopancreas was sensitive to chronic continuous Cd exposure only for high dietary doses, which are rarely encountered under field conditions. Its sensitivity as a biomarker of sublethal stress was, however, similar to those observed for hypometabolism tendency and body weight changes. In addition, the other methylation parameters investigated here seemed to be unresponsive to oral cadmium given as cadmium nitrate. Taken together, these findings considerably disfavor the use of genome-wide DNA methylation levels in gastropods as biomarkers of cadmium exposure at levels relevant for environmental and human health. However, these data can provide us with a rough estimate of the lowest-observable-effect concentration (LOEC) of cadmium required for inducing changes in total 5mC content of the hepatopancreas; under the present experimental conditions, between 80 and 100 mg/kg d. wt.

The present experimental design did not allow us to determine whether the changes observed for the aforementioned variables share a common physiological background, derive one from another, or are totally independent. Although there is no information linking DNA methylation with metabolism in gastropods, there is relevant evidence for such an association in other invertebrates undergoing aestivation to endure adverse environmental conditions. Thus, the Japanese sea cucumber, Apostichopus japonicus (Selenka, 1867), exhibits intestinal hypometabolism during aestivation via DNA hypermethylation-mediated transcriptional suppression of metabolic pathways (Li et al., 2018). Since the snails were maintained under controlled laboratory conditions (optimal for their well-being), it is plausible that this tendency towards reduced metabolic activity (stop/reduce feeding and enter into aestivation) is not related to desiccation or lack of fodder. Rather, this phenomenon may reflect Cd-induced changes in key enzymes of the DNA methylation machinery (e.g., DNA methyltransferases, Ten Eleven Translocation enzymes, Methyl-CpG-binding domain proteins). Indeed, chronic exposure to cadmium can yield such effects by increasing the levels of DNA methyltransferases (DNMTs), as already described in rat cells (Takiguchi et al., 2003), and further lead to DNA hypermethylation, hypometabolism, aestivation, body weight reduction, and death. Moreover, recent data suggests that C. aspersum possesses functionally active DNMT1 gene, but not DNMT3 gene, and this gene is sensitive to cadmium exposure (Draghici et al., 2020).

The present study focused on cadmium, but did not determine the levels of other metals in food or snail body. Such measurements could be important since humans and wildlife are exposed under real-life conditions to complex mixtures of metals and chemicals, with exposure to a single metal/chemical rarely yielding a dominant effect. There is relevant evidence that cadmium feeding can perturb metal homeostasis in invertebrates and co-exposure to metal mixtures may interfere with the toxic effects of cadmium, potentially yielding synergistic effects. Thus, for cladocerans Daphnia magna (Straus, 1820) and Moina macrocopa (Straus, 1820), mixtures of copper (Cu), lead (Pb), Cd, nickel (Ni), and zinc (Zn) exerted stronger multi-generational effects on growth, reproduction, and population dynamics than single exposure to Cd (Sun et al., 2021). Moreover, gastropods fed Cd-spiked diets displayed altered Cu and manganese (Mn) balance (Nica et al., 2019).

These findings highlight the practical difficulties which arise when investigating the effect of cadmium and other environmental toxicants on DNA methylation in terrestrial snails. Moreover, Cd concentrations in food and vegetables of importance for animal and human nutrition are typically well below the levels causing significant changes in total 5mC content of gastropod DNA (Panel, 2009). However, one cannot exclude the presence of targeted changes in DNA methylation at specific genes, gene regions (e.g., at gene bodies), and genomic areas in the ovotestis, hepatopancreas, or other organs for environmentally realistic levels of exposure. In fact, DNA methylation in the marine mollusk Crassostrea gigas (Thunberg, 1793) is responsive to environmental stress, especially in gene networks with inducible expression (Gavery & Roberts, 2010). In addition, specimens of freshwater snails P. acuta exposed to the fungicide vinclozolin (VZ) revealed consistent changes in regional DNA methylation patterns (Sanchez-Arguello et al., 2016). Unfortunately, it is currently not possible to conduct high-resolution DNA methylation analysis in land snails due to the limited number of reference genomes available, scarce information about gastropod methylome, and the presence of a partially sequenced transcriptome for the brown garden snail, Cornu aspersum (Parmakelis et al., 2017; Fallet et al., 2020). In this context, obtaining a complete genome sequence and annotation for C. aspersum and land snail species of (eco)toxicological importance, as well as sequencing and deciphering their methylomes, are sine qua non conditions to elucidate the potential of DNA methylation in these mollusks to serve as toxicological endpoints for cadmium and other environmental contaminants.

Most studies to date have used ELISA (Joe, 2013; Muller et al., 2016; Geyer et al., 2017; Nica et al., 2017a; Aparicio, 2021; Georgescu et al., 2021), and much rarely liquid chromatography-tandem mass spectrometry (LC-MS/MS) and other chromatography- based methods (Fneich et al., 2013), for quantitative measurement of genome-wide DNA methylation in land snails. The later approach is regarded as the gold standard in methylation analysis, but is expensive and requires MS expertise despite being sensitive, quantitative, and reproducible (Liu, Hesson & Ward, 2013). On the other hand, ELISA-based methods are cost-effective and fast, but sensitive to the quality of DNA and prone to higher variability compared to chromatography- based methods (Liu, Hesson & Ward, 2013). As a result, future studies should use chromatography-based methods to validate ELISA results. Another possibility is to use the dot blot assay. This method has been already validated on other mollusk species, and as an advantage, it is more cost effective than ELISA-based methods (Luviano et al., 2021).