Adjuvant Pam3CSk4 does not improve the immunization against Cryptococcus gattii infection in C57BL/6 mice

Animals

Male C57BL/6 mice (6–8 weeks old) were acquired from the animal facility at the Campus of Ribeirão Preto of the University of São Paulo, Brazil. The mice were housed in the animal facility of the Department of Cell and Molecular Biology and Pathogenic Bioagents of Ribeirão Preto Medical School, and all animal experiments were performed according to the Ethical Principles Guide for the Care and Use of Laboratory Animals adopted by the Brazilian College of Animal Experimentation. The protocols were approved by the Committee on Ethics in Animal Research of Ribeirão Preto Medical School (protocol 072/2019). Mice were anesthetized with ketamine hydrochloride (20.0 mg/kg, i.p.) and xylazine hydrochloride (2 mg/kg, i.p.) as previously reported (Oliveira-Brito et al., 2022), and the euthanasia was performed in the end period of C. gattii infection.

Culture of Cryptococcus gattii and heat inactivation of yeasts

R265 C. gattii strain (B serotype, VGII molecular genotype) was recovered from 25% glycerol stocks stored at −80 °C and cultured on Sabouraud dextrose medium at 30 °C with constant agitation (150 rpm) for 16–18 h. C. gattii yeast with a thin capsule (C. gattii-thin) were obtained after inoculation in YPD medium containing 0.5 M NaCl, as described by Ikeda-Dantsuji et al. (2015), and incubated at 30 °C with constant agitation at 150 rpm for 20–24 h. Yeast cells were harvested by centrifugation at 7,600 × g for 10 min at 25 °C and washed three times with sterile PBS (Thermo Fisher Scientific, Waltham, MA, USA). C. gattii-thin was heat-inactivated at 70 °C for 1 h (HK-C. gattii-thin). The cell concentration was determined using a Neubauer chamber with Chinese ink. A fraction of the HK-C. gattii-thin yeast was spread on Sabouraud dextrose agar to confirm the heat inactivation.

C57BL/6 mice were infected with viable yeast of C. gattii that were cultured on Sabouraud dextrose medium at 30 °C with constant agitation (150 rpm) for 16–18 h. Yeast cells were harvested by centrifugation at 7,600 × g for 10 min at 25 °C and washed three times with sterile PBS (Thermo Fisher Scientific). Cell concentration was determined using a Neubauer chamber with Chinese ink.

Protocol of immunization of mice in association with adjuvant P3C4

Mice were anesthetized with ketamine hydrochloride (20.0 mg/kg, i.p.) and xylazine hydrochloride (2 mg/kg, i.p.). Animals were immunized with a cell suspension of 2 × 10⁷ H.K.-C. gattii with or without P3C4 (1 or 10 µg/mouse) intranasally, and the control group received PBS alone (n = 5 in each group). Immunization was performed three times with a two-week interval among them (on day 1, 14 and 28). The animals were separated into the following groups: PBS, Immunized, Immunized +P3C4 (1 µg), and Immunized +P3C4 (10 µg). On day 35, the blood was collected to measure the levels of IgM and IgG anti-GXM. On day 42, mice were anesthetized and infected with 1 × 10⁵ C. gattii yeast cells intranasally. Fourteen days after infection (day 56), the animals were euthanized to collect blood samples and lungs.

Fungal burden in the lungs measured by CFU

The lungs of the animals were removed 14 days after C. gattii infection (day 56), and the tissue was stored in one mL cold 1x sterile PBS buffer (pH 7.2) and immediately weighed and homogenized (IKA Werke, Staufen, Germany). Suspensions of homogenized lung tissue were diluted and plated on Sabouraud dextrose (Oxoid) agar medium containing 100 µg/mL ampicillin. The plates were incubated at 30 °C for 48 h, and the C. gattii colonies were counted to perform the colony forming unit (CFU) assay, which is expressed in CFU/g.

Serum immunoglobulin isotyping

After 14 days of C. gattii infection (day 56), the serum was obtained from all mice to quantify the levels of the immunoglobulins isotyping (IgG1, IgG2a, IgG2b, IgG3, IgM, and IgA along with kappa and lambda light chains) using the Easy-Titer™ Mouse IgG Assay Kit (Thermo Fischer Scientific) as previously reported (Oliveira-Brito et al., 2022).

Quantification of the levels of IgG and IgM antibodies specific to GXM

The levels of IgG and IgM anti-GXM in the serum of the animals were measured 7 days after the immunization protocol (day 35) and it was performed in 96-well microplates coated with 20 µg/mL GXM isolated from C. gattii, as described by Wozniak and Levitz (Wozniak & Levitz, 2009), and incubated overnight at 4 °C. The plate was washed three times with wash buffer (PBS-Tween 20; 0.05%) and incubated with MOLICO^® skim dry milk powder (1.0%) for 2 h at 25 °C (room temperature, RT) for blocking. The plate was washed five times and mouse serum was added and incubated for 2 h at RT, furthermore, the plate was washed five times. Then, goat anti-mouse IgM (μ-chain specific)-peroxidase antibody (1:2500, Cat# A8786; Sigma-Aldrich, St. Louis, MO, USA) or rabbit anti-mouse IgG (whole molecule)–peroxidase antibody (1:5000, Cat# A9044, Sigma-Aldrich) was added in the plate and incubated for 1 h. The plates were washed seven times and 50 µL 3,3′,5,5′-tetramethylbenzidine (TMB) substrate solution was added. After 30 min of incubation at RT, 30 µL of stop solution (2N H₂SO₄) was added. Absorbance was recorded at 450 nm using a spectrophotometer (Power Wave X; BioTek Instruments, Winooski, VT, USA).

Quantification of cytokine levels in the lungs

Lung homogenates of the animals were obtained 14 days after C. gattii infection (day 56). The tissue was stored in one mL cold 1x sterile PBS buffer (pH 7.2), immediately weighed, and homogenized (IKA Werke, Staufen, Germany). The supernatant was collected after centrifugation (3,220 × g, 10 min) and a protease inhibitor was added (phenylmethylsulfonyl fluoride, PMSF). Cytokine levels were quantified by ELISA using the OptEIA™ Kit (Pharmingen, San Diego, CA, USA) according to the manufacturer’s instructions. IFN-γ, IL-12(p70), IL-10, IL-4, IL-17A, TNF-α, IL-1β, IL-2, and IL-6 levels were measured in the lungs, and IFN-γ, IL-17, and IL-4 levels were quantified in the serum. The levels of cytokines in the tissues were normalized relative to the organ mass (mg) and expressed in pg/mL.

Phenotyping of immune cells in the pulmonary tissue by flow cytometry

Pulmonary leukocytes were obtained as previously described by Oliveira-Brito et al. (2020). Prior to phenotyping the cell populations in the lungs, the concentrations of the cell suspensions were determined using a Neubauer chamber, and 1 × 10⁶ cells/mL from each sample were stained with antibodies conjugated to fluorophores. Cells were incubated for 30 min at 4 °C with 0.5 µg of anti-CD16/CD32 monoclonal antibody (Fc block, clone 2.4G2; BD Pharmingen, San Diego, CA). Subsequently, 5 µg/mL of the following antibodies (obtained from BD Pharmingen) were used: anti-CD3 (PE-Cy5 Rat anti-Mouse CD3; clone 17A2), anti-F4/80 (FITC rat anti-mouse F4/80; clone BM8), anti-CD11c (PE Hamster Anti-Mouse CD11c; clone HL3) and anti-TLR2-PE (PE rat anti-mouse TLR2; clone 6C2). The cells were incubated for 45 min with the antibodies, and washed twice with PBS buffer and fixed with PBS-formaldehyde (1%). After these steps, the percentage of cells positive for CD3, F4/80, or TLR2 was measured using flow cytometry (Guava easyCyteTM Mini System).

Analysis of the profile of CD4⁺ T cells and macrophage subtypes in the lung tissue by qRT-PCR

Total RNA was isolated from the lung cells using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNA was converted to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, CA, USA). qRT-PCR was performed in a final volume of 10 µL using the EvaGreen Supermix (Bio-Rad). The CFX96 Touch System (Bio-Rad, Hercules, CA, USA) was used under the following reaction conditions: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 91.5 °C -−95 °C for 5 s. CD4 ⁺ T cell differentiation was determined by the relative expression of T-bet, ROR γt, GATA-3, Foxp3, and TGF-β transcripts, and macrophage polarization was evaluated by the relative transcript expression of Arginase-1, iNOS, and IL-23. Relative transcript expression was quantified using the ΔΔCt method and normalized to β-actin expression. The primers used for PCR reaction were: β-actin (F: 5′-CCTAAGGCCAACCGTGAAAA-3′/R: 5′-GAGGCATACAGGGACAGCACA-3′), T-bet (F: ′-CACTAAGCAAGGACGGCGAA-3′/R: 5′-CCACCAAGACCACATCCAC-3′), ROR γT (F: 5′-TGGAAGATGTGGACTTCGTT-3′/R: 5′-TGGTTCCCCCAAGTTCAGGAT-3′), GATA-3 (F: 5′-AAGAAAGGCATGAAGGACGC-3′/R: 5′-GTGTGCCCATTTGG ACATCA-3′), Arginase-1 (F: 5′-GTTCCCAGATGTACCAGGATTC-3′/R: 5′-CGATGTCTT TGGCAGATATGC-3′), iNOS2 (F:5′-CCGAAGCAAACATCACATTCA-3′/R: 5′-GGTCTAAAGGCTCCGGGCT-3′), IL-23 (F: 5′TCCGTTCCAAGATCCTTCGA3′/R: 5′TGTTGGCACTAAGGGCT CAG3′), Foxp3 (F: 5′-ATTGAGGGTGGGTGTCAGGA-3′/R: 5′-TCCAAGTCTCGTCTGAAGGCA-3′), and TGF-β (F: 5′-GACTCTCCACCT GCAAGACC-3′/R: 5′-GGGACTGGCGAGCCTTAGTT-3′).

Histopathological and morphometric analysis of the pulmonary tissue

The procedures to obtain the lungs and the preparation of tissue samples for histology were performed as reported by (Oliveira-Brito et al., 2022; Oliveira-Brito et al., 2022). Moreover, the sections were stained with hematoxylin and eosin (H&E), Grocott–Gomori methenamine silver and mucicarmine to be evaluated as previously reported (Oliveira-Brito et al., 2022). The images acquired were used to quantify the percentage of inflammatory infiltrate using a semi-automated quantitative manner using ImageJ Fiji. Quantification of inflammatory infiltrates was performed in four sections (6,3X magnification) subdivided into grids (269568.2 µm²) in a total area of one mm² per animal.

Statistical analysis

All data were analyzed using Prism 7.0 (GraphPad Software, San Diego, CA, USA), and the results were expressed as mean ± standard deviation (SD). Homogeneity of variance was analyzed using the Kolmogorov–Smirnov test. For all data with Gaussian distribution, an ANOVA test followed by Bartlett’s test was applied to the three groups of experiments (PBS, Immunized and Immunized-1 µg, or Immunized-10 µg). In all data with a non-normal distribution, the Kruskal–Wallis test was applied to the three groups of experiments. To determine the differences between the means of groups (p <0.05), one-way ANOVA followed by Tukey’s multiple comparisons test or Kruskal–Wallis test followed by Dunn’s multiple comparisons test was performed.

Adjuvant P3C4 does not favor the development of immunoglobulin isotypes with effector function against C. gattii

Previous studies demonstrate the importance of TLR2 agonists in inducing a pro-inflammatory response that culminates in the control of infectious diseases (Chua et al., 2008; Komegae et al., 2013; Salgado et al., 2019). Intranasal administration of TLR2 agonists can provide protection against several pathogens, including SARS-CoV-2 and influenza viruses (Proud et al., 2021; Tan et al., 2012), and gram-negative bacteria Chlamydia trachomatis (Cheng et al., 2011a), and Bordetella pertussis (Allen et al., 2018). The immunomodulatory activity of the TLR2 agonist (Pam3CSK4 or P3C4) has not been evaluated as an adjuvant associated with an immunization protocol to combat fungal infections. Therefore, this work performed the immunization of mice via intranasal administration, using heat-killed C. gattii yeast associated with the adjuvant P3C4 to control C. gattii infection.

C57BL/6 mice were immunized with three inoculums of heat-killed C. gattii yeast with or without P3C4 (1 or 10 µg/mouse) at a two-week interval (on day 1, 14 and 28). The animals were infected with live C. gattii on day 42, as shown in Fig. 1A. Serum was used to measure the levels of IgM (Fig. 1B) and IgG (Fig. 1C) anti-GXM at 14 days post-immunization (day 35), and the levels detected in mice immunized and treated with adjuvant P3C4 did not differ from those of mice immunized alone (Figs. 1B–1C). In addition, serum was obtained 14 days after infection (day 56) to measure the levels of immunoglobulins IgG1, IgG2a, IgG2b, IgG3, IgA, IgM, and kappa/lambda chains. The levels of IgG1, IgG2a, and IgA isotypes in the mice that received 1 µg of adjuvant P3C4 were significantly lower than those in the immunized group (Fig. 1D), whereas the levels of IgG2b, IgG3, IgM, and kappa and lambda isotypes did not change significantly between groups. Mice treated with 10 µg of adjuvant P3C4 showed increased levels of the kappa chain compared with the immunized group (Fig. 1D). Taken together, these data demonstrate that the administration of adjuvant P3C4 did not improve the serum levels of immunoglobulin isotypes with effector functions against fungi, and the levels of GXM-specific antibodies did not change.

High doses of adjuvant P3C4 downregulate the levels of pro-inflammatory cytokines in the lungs

To evaluate the immunomodulation triggered by the immunization protocol, cytokine levels in the lungs and serum were quantified 14 days after C. gattii infection (day 56). The supernatant of the mouse lung homogenate was used to quantify the levels of IFN-γ, IL-12p70, TNF-α, IL-1β, IL-2, IL-17, IL-6, IL-10, and IL-4 (Figs. 2A–2I), while IFN-γ, IL-17, and IL-4 (Figs. 2J–2L) levels were measured in the serum. Immunization with heat-killed C. gattii yeast in association with 1 µg of P3C4 did not significantly change the levels of IFN-γ, IL-12p70, TNF-α, IL-2, IL-6, IL-10, and IL-4 (Fig. 2) in the lung tissue compared to the PBS and immunized groups. However, the adjuvant P3C4 −1 µg group had significantly higher levels of IL-1β (Fig. 2D) and IL-17 (Fig. 2F) in the lung tissue than the PBS and immunized groups. In contrast, administration of 10 µg of P3C4 as an adjuvant resulted in the reduction of IFN-γ (Fig. 2A), IL-12p70 (Fig. 2B), IL-6 (Fig. 2G), and IL-10 (Fig. 2H) levels in the lungs. Interestingly, the levels of IL-17 detected in the lung tissue of mice that received 10 µg of adjuvant P3C4 remained elevated in comparison to those in the immunized group (Fig. 2F), which was also observed in the P3C4-1 µg group. The downregulation of pro-inflammatory cytokines in the lungs promoted by the administration of 10 µg of P3C4 favored an increase in the levels of IL-4 in the serum, compared to the immunized group (Fig. 2L). Thus, the administration of 1 µg of P3C4 as an adjuvant contributed to the predominance of Th17-associated cytokines in the lung tissue, and pro-inflammatory cytokines essential to combat cryptococcosis were negatively regulated in lung tissue in the P3C4 −10 µg group.

The frequency of TLR2+ cells in the lungs is altered by administration of the adjuvant P3C4

Since alterations in cytokine levels were observed in the lungs of immunized mice that received adjuvant P3C4, the frequency of alveolar macrophages, T cells, and TLR2+ cells could indicate immunomodulatory activity induced by 1 and 10 µg of P3C4. Therefore, a suspension of pulmonary leukocytes obtained from each group was incubated with anti-CD3, anti-F4/80 or anti-CD11c antibodies, and the frequency of T cells, alveolar macrophages and dendritic cells was measured by flow cytometry (Figs. 3A–3C). On day 56, the frequency of T cells (Fig. 3A) was decreased in the P3C4-10 µg group. The frequency of alveolar macrophages (Fig. 3B) and dendritic cells (Fig. 3C) measured in the P3C4 −1 µg and P3C4 −10 µg groups was not significantly different from that in the immunized and PBS groups. In contrast, immunized mice that received 1 µg of P3C4 had a significant increase in the frequency of TLR2⁺ cells compared with the immunized group, but not in the P3C4 −10 µg group (Fig. 3D). The level of TLR2 expression was determined by mean fluorescence intensity (MFI), and the immunized mice that received 10 µg of adjuvant P3C4 had a lower expression of TLR2 within pulmonary leukocytes than the immunized group (Fig. 3E). These data demonstrated that adjuvant P3C4 modulates the frequency of TLR2⁺ cells in the lungs and 10 µg of adjuvant P3C4 decreases the frequency of T cells, whereas the phenotypes of T cells (P3C4-1 μg), alveolar macrophages and dendritic cells are unaltered.

Low doses of the adjuvant P3C4 provide a predominance of the transcription factor Foxp3 in the lung tissue

In addition to evaluating the phenotype of T cells and alveolar macrophages in the lung tissue, the differentiation of macrophages and CD4⁺ T cells was investigated by qRT-PCR using molecular markers that characterize M1/M2 subsets (iNOS and Arginase-1, respectively) and Th1/Th2/Th17/Treg profiles (T-bet, Gata-3, ROR-gt, and Foxp3, respectively). The relative expression of iNOS and Arginase-1 quantified in all groups did not differ (Figs. 4A–4B). Markers of CD4⁺ T cell differentiation in pulmonary tissue demonstrated that immunized mice that received 1 µg of adjuvant P3C4 showed a reduction in the relative expression of T-bet (Fig. 4C) and an increase in Foxp3 (Fig. 4F), which are related to Th1 and Treg cells, respectively. The relative expression of the markers of CD4⁺ T cell differentiation was not affected in the P3C4 −10 µg group compared with the control groups (Figs. 4C–4F). Additionally, the relative expression of IL-23 and TGF- β, which are involved in the initiation/maintenance of IL-17 production, was not significantly altered in either the P3C4 −1 µg or P3C4 −10 µg groups in comparison to the PBS and immunized groups (Figs. 4G–4H). Taken together, these data indicate that the administration of 1 µg of adjuvant P3C4 provided a predominance of transcription factors that characterize regulatory CD4+ T cells (Tregs) in the lung tissue.

Adjuvant P3C4 is unable to contribute to the reduction of the C. gattii burden in the lungs

Previous studies have demonstrated that the regulatory effect of Treg cells in the lung microenvironment of cryptococcosis can modulate allergic airway inflammation by suppressing Th2 cells and controlling C. neoformans burden (Schulze et al., 2014a; Schulze et al., 2014b; Schulze et al., 2016). Therefore, in the present study, adjuvant P3C4-1 µg induced an increase in the expression of the Foxp3 transcription factor in the lungs, which could indicate the differentiation of Treg cells; otherwise, the production of IL-17 and IL-1β was increased in the P3C4 −1 µg group. These factors influence the balance of the immune response against cryptococcosis, which requires quantification of the fungal burden in the lungs to evaluate the effect of adjuvant P3C4 in the control of C. gattii infection. The lung homogenates of immunized mice that received 1 µg or 10 µg of adjuvant P3C4 were obtained 14 days after C. gattii infection (day 56) to measure the fungal burden by the CFU assay. The groups with 1 µg or 10 µg of adjuvant P3C4 showed a pulmonary C. gattii burden that was not significantly altered when compared with the immunized group (Fig. 5). Therefore, the current findings related to the immunomodulatory activity of adjuvant P3C4 in the lungs show that it does not aid in the control of C. gattii infection.

Low doses of the adjuvant P3C4 reduced the percentage of pulmonary parenchymal affected by inflammatory infiltrate

Considering that C. gattii has a predilection for the pulmonary tissue, histopathological and morphometric analysis of the lungs were performed to evaluate the architecture of the lungs and the distribution of inflammatory infiltrate throughout whole tissue. In all groups evaluated, the histopathological analysis demonstrated focal and multiple pulmonary nodular lesions in the sections (Figs. 6A–6D). PBS, Immunized, and Immunized + P3C4 −1 µg and −10 µg groups presented multiple nodular lesions with either low or high concentrations of inflammatory infiltrate composed, respectively, of mononuclear cells surrounded or robust lymphocytes infiltration with the presence of neutrophils (Figs. 6A–6D); moreover, the nodular lesions contained oval or rounded yeast cells diffusely distributed or restricted to the vacuolated cytoplasm of macrophages (Figs. 6I–6P). In addition, perivasculitis and peribronchiolitis were observed in all groups studied (Figs. 6I–6P). To visualize the distribution of fungi, the sections were stained with Grocott and Mucicarmine that demonstrated high frequency of C. gattii within the nodule lesions as observed in the Immunized + P3C4 −1 µg and −10 µg groups (Figs. 6E–6H). Specifically, the nodules lesions and the distribution of fungi were similar between PBS and untreated groups, whereas Immunized + P3C4 −1 µg and −10 µg groups had more prevalent focal nodular lesions with high frequency of C. gattii in the alveolar spaces (Figs. 6I–6P). These findings were complemented by the morphometric analysis of the percentage of inflammatory infiltrate throughout the whole tissue, and the mice that received 1 µg of adjuvant P3C4 showed a lower percentage of inflammatory infiltrate in relation to the area of pulmonary parenchymal, compared to Immunized and P3C4 −10 µg groups (Fig. 6Q). Taken together, these data indicate that different doses of adjuvant P3C4 can alter the distribution of inflammatory infiltrate in the lungs and the frequency of C. gattii yeast in the alveolar spaces.