Visitors   Views   Downloads
NOT PEER-REVIEWED
"PeerJ Preprints" is a venue for early communication or feedback before peer review. Data may be preliminary.

Supplemental Information

Multiple alignment of translated cloned sequences from Tuta absoluta and homologues from other insect species

For Vacuolar ATPase subunit-A: Aedes aegypti (XP_001659520.1); Drosophila melanogaster (NP_652004.2); Tribolium castaneum (XP_976188.1); Manduca sexta (P31400.1); Bombyx mori (NP_001091829.1); Tuta absoluta (KM591219). Arginine Kinase: Spodoptera litura (ADW94627.1); Helicoverpa armigera (ADD22718.1); Bombyx mori (NP_001037402.1); Tribolium castaneum (EFA11419.1); Homalodisca vitripennis (AAT01074.1); Drosophila melanogaster (AAA68172.1); Tuta absoluta (KM591220).

DOI: 10.7287/peerj.preprints.2406v1/supp-1

High magnification of the trajectory of Cy3-labeled dsRNA molecules through the tomato leaflets

Detail of various regions on the treated leaf, indicating the dsRNA distribution over leaf areas (bar = 200 μm).

DOI: 10.7287/peerj.preprints.2406v1/supp-2

Agroinfiltration experiments with Agrobacterium expressing eGFP or eGFP plus GFPi

(A) Expression of eGFP in tomato leaf infiltrated with Agrobacterium suspension containing plasmid with eGFP, visualized under a confocal fluorescent microscope. (B) Infiltration of tomato leaf with two Agrobacterium clones, expressing eGFP together with a construct expressing GFPi, indicating reduction in GFP expression visualized under confocal fluorescent microscope. (C) tomato leaf tissues at a distance away from the area infiltrated with Agrobacterium suspension containing plasmid with eGFP (bar = 100 μm).

DOI: 10.7287/peerj.preprints.2406v1/supp-3

RNAi effects on larval development.

Tuta absoluta individuals after feeding for 11 days in tomato leaflets, after absorbing 500 ng dsRNA of the GFP control (a) and the target genes V-ATPase (b) or AK (c). Total amount of individuals at pupal stage, resultant from the larvae feeding on GFP control (d) and the target genes V-ATPase (e) or AK (f)

DOI: 10.7287/peerj.preprints.2406v1/supp-4

Amplification detection of expressed sequences (cDNA; siRNA and microRNA) from various transgenic events

(A) Detection of amplification products from cDNA (RT-PCR) extracted from various transgenic ‘Micro-tom’ events and non-transformed control (WT) using primers specific for insect V-ATPase (top panel; 139 bp) or AK (bottom panel;190 bp), and tomato ubiquitin (108 bp). (B). Detection of amplification products derived from stem loop pulsed RT-PCR for potential siRNA derived from target genes (V-ATPase or AK, both 60 bp), plus the microRNA156 (MIR156; 60 bp) control ran at 3% agarose gel electrophoresis. Numbers represent events (1st number) or plants within events (2nd number).

DOI: 10.7287/peerj.preprints.2406v1/supp-5

List of degenerated primers

Degenerated primers used to amplify and clone respective candidate gene targets for RNAi, with expected amplicon size for each reaction. Numbers refer to primer order used in amplification reactions.

DOI: 10.7287/peerj.preprints.2406v1/supp-6

List of primers for Gateway construct

Primers used to amplify target gene fragments with Gateway recombination borders attL1 and attL2 (underlined), with expected amplicon size (bp).

DOI: 10.7287/peerj.preprints.2406v1/supp-7

Summary of three transformation experiments using construct containing repetitive and inverted gene fragments

DOI: 10.7287/peerj.preprints.2406v1/supp-8

Specific primers designed for transcriptional analysis of gene-targets for silencing, with expected amplicon size in base pairs

DOI: 10.7287/peerj.preprints.2406v1/supp-9

List of primers to detect siRNA in transgenic plants

Gene-specific and the universal primer sequences used to detect the predicted small interfering RNAs (siRNA) derived from the target genes V-ATPase (siRNA AATACATGCGCGCTCTAGATGAC) and AK (siRNA AAGTATCGTCCACACTGTCTGGC) and the control microRNA156 (UGACAGAAGAGAGUGAGCAC) in transgenic plants.

DOI: 10.7287/peerj.preprints.2406v1/supp-10

Additional Information

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Roberto A Camargo performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.

Guilherme O Barbosa analyzed the data, prepared figures and/or tables, reviewed drafts of the paper.

Isabella Presotto Possignolo performed the experiments, reviewed drafts of the paper.

Lazaro E. P. Peres analyzed the data, contributed reagents/materials/analysis tools, reviewed drafts of the paper.

Eric Lam contributed reagents/materials/analysis tools, reviewed drafts of the paper.

Joni E Lima conceived and designed the experiments, analyzed the data, wrote the paper, reviewed drafts of the paper.

Antonio V. O. Figueira conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.

Henrique Marques-Souza conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.

Data Deposition

The following information was supplied regarding data availability:

Raw data of the qPCR analyses

The data will be available in the following link:

https://www.dropbox.com/sh/dkgvlfded5n97z0/AACPiIasuyH33_wzssMBWA5ea?dl=0

Funding

This work was financially supported by ‘Fundação de Amparo à Pesquisa do Estado de São Paulo – FAPESP’ through a Regular Grant (2011/12869-6), and a fellowship to JEL (2010/11313-1). RAC was a recipient of a CAPES fellowship, and GOB, IP, LEPP, and AF received financial support from CNPq (Brazilian National Research Council). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.


Add your feedback

Before adding feedback, consider if it can be asked as a question instead, and if so then use the Question tab. Pointing out typos is fine, but authors are encouraged to accept only substantially helpful feedback.

Some Markdown syntax is allowed: _italic_ **bold** ^superscript^ ~subscript~ %%blockquote%% [link text](link URL)
 
By posting this you agree to PeerJ's commenting policies