Enriched environment improves working memory impairment of mice with traumatic brain injury by enhancing histone acetylation in the prefrontal cortex

Animals

All experimental procedures were carried out in accordance with the ARRIVE guidelines, and all experiments with mice were approved by the Animal Ethics Committee of Yangzhou University. Clean-grade mice (Species: Kunming, gender: male, age: postnatal week 6–8, body weight: 25–30 g) were provided by the Experimental Animal Center of Yangzhou University. All mice were housed under appropriate temperature (25 °C) and humidity (60%) in controlled atmosphere of 12 h–12 h light-dark cycle, and had free access to both water and food (Wang et al., 2016).

Brain injury model

The modified free-fall method was used to establish the mouse model of closed head injury (Kumar, Herbst & Strickland, 2012). Briefly, the device constitutes a vertical guide tube (13 mm inner diameter), dropping weights and a stereotactic frame. The mouse was anesthetized with an intraperitoneal injection of 0.15 ml 1% pentobarbital sodium, and the mouse head was fixed in a stereotactic frame. A 40 g weight from a height of 80 cm was freely fell down along a vertical tube, and struck the skull at the spot 2 mm lateral from the Bregma on the right (Fig. 1). A sponge was used to support the head to ensure no head rotation movement occurring during the impact, but some anteroposterior motion was allowed. Five minutes after the impact, the mice were put back into the cages for recovery. Sham-operated mice went through the same procedure, but the dropping weights procedure was removed. After surgery, all the mice including TBI mice and sham-operated mice were housed in the cages with standard environment for 14 days. Mice with TBI that could walk straight after 14 days, without bending towards one side, were screened for Y-maze test. Those TBI mice whose percentage of spontaneous alternations in the Y-maze test had significant difference compared with those of the sham-operated mice (p < 0.05) were identified as mice with working memory impairment and selected for further study (Wang et al., 2016). At the end, there were at least 60 TBI mice with working memory impairment.

Y-maze test

A Y-maze test for evaluating spatial working memory was performed in this study (Tucker, Fu & McCabe, 2016). The test was completed within a day. The apparatus was composed of three identical arms that was made up of plexiglass (30 cm long, 8 cm wide and 16 cm high) positioned at equal angles 120°. During the test, the mouse was placed in the middle of the fixed arm and faced to the center of the maze (Fig. 2A). Then the mouse was allowed to explore the maze freely for 8 min. One arm entry was defined as all 4 paws of the mouse crossed the threshold of the central zone and into the arm and the animal’s snout was oriented toward the end of the arm (Fig. 2B). A correct alternation was defined as the mouse that entered a different arm of the maze in each of 3 consecutive arm entries. The maximum number of alternations was equal to the sum of arms that the mouse entered minus two. The spontaneous alternation rate was calculated with the following formula: spontaneous alternation % = (number of correct alternations/number of maximum alternations) ×100%. The total number of arms entered was also recorded.

Study design (Wang et al., 2016)

The selected TBI mice with working memory impairment were randomly assigned to 2 groups: TBI mice that lived in Standard Environment (TBI+SE), and TBI mice that lived in Enriched Environment (TBI+EE). Sham-operated mice still lived in Standard Environment. So the specific design of this study is as follows. Thirty TBI+SE mice and 30 sham-operated mice (SHAM+SE) were housed in standard cages (32 cm long ×20 cm wide ×13 cm high). Another 30 TBI+EE mice were caged in larger ones (60 cm long ×36 cm wide ×28 cm high) containing several shapes and colors of rodent toys and the running wheels. Toys were changed every four days regularly. The mice in different groups were housed in different environmental conditions (24 h a day) for 4 weeks before second Y-maze test .

Brain sample preparation

The prefrontal cortex is the most related organ to working memory (Jimura et al., 2017; Sherwood et al., 2016). The left prefrontal cortex of mouse was selected for further analysis because the right frontal cortex was destroyed directly by TBI. After Y-maze test, all mice were sacrificed and the left prefrontal cortex was removed. After that, the brain tissues were quickly frozen in liquid nitrogen and stored at −80 °C for subsequent acetylcholine (Ach) level assessment and chromatin immunoprecipitation (ChIP) assay, as well as quantitative real-time polymerase chain reaction (Q-PCR), and western blotting analysis. Every 12 frozen left frontal cortex per group were used for western blotting analysis and every six frozen left frontal cortex per group were used for other different detection methods (Wang et al., 2016).

Ach assay

Ach detection kit (Jiancheng, China) was used to detect the Ach levels (Wang et al., 2016) according to the manufacturer’s instructions. The concentration of Ach was calculated via the following equation: Ach concentration(_{µg/mg protein}) =(OD_Sample − OD_{Blankstandard})∕(OD_{Blankstandard} − OD_Blank) × 400 × F. F means the dilution factors of the sample protein concentrations, and OD refers to the optical density.

RNA extraction and quantitative real-time PCR (Q-PCR)

Total RNA were extracted by using the RNA isolation kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. cDNA was synthesized from isolated RNA template by using avian myeloblastosis virus reverse transcriptase. The mRNA transcription of ChAT gene was detected and the primers used were as follows: forward primer (Akpan et al., 2008), (5′∼3′, AGC CCT GCT GTG ATC TTT GCT CG); reverse primer, (5′∼3′, CCT TGG CCC AGT CAG TGG GAA). Primers specific for GAPDH were used as control: forward primer (Wang et al., 2016), (5′∼3′, GTC ATA TTT CTC GTG GTT CAC ACC); reverse primer, (5′∼3′, CTG AGT ATG TCG TGG AGT CTA CTG G). The Q-PCR reaction conditions were as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 45 s, 60 °C for 50 s, and 72 °C for 30 s. Q-PCR was performed by Sequence Detection System.

Western blot assay

Proteins extracted from brain tissues (left prefrontal cortex of mouse) were separated via SDS-PAGE (Wang et al., 2016). Then the proteins were transferred onto nitrocellulose membranes and complexed with the following antibodies: ChAT (1:1,000, Merck Millipore), H3 (1:1,000, Bioworld), Ac-H3 (1:1,000, Bioworld), H4 (1:1,000, Bioworld), Ac-H4 (1:1,000, Bioworld) and CBP (1:1,000, Bioworld). Horseradish peroxidise (HRP)-conjugated anti-goat or anti-rabbit IgG antibodies (secondary antibody) were used to visualize the location of separated proteins via enhanced chemiluminescence. Finally, the membrane was exposed to film, and the blot intensity was quantified with densitometry. GAPDH was used as the loading control.

Chromatin immunoprecipitation (ChIP) assay

Magna ChIP G tissue kit (Merck Millipore) was used in this study (Wang et al., 2016). During ChIP assay, prefrontal cortex was initially treated with tissue stabilization solution from the kit. Then, formaldehyde was used to cross-link the genomic DNA to chromatins. Subsequently, the compound was broken into 200–1,000 bp long fragments with a sonicator. After that, the chromatin lysate was incubated with rabbit anti mouse acetyl histone H3 antibody (1:1,000, Merck Millipore) or IgG (negative control) at 4 °C overnight under constant rotation. Subsequently, immune complex wash buffer was used to evaluate the cross-linked protein/DNA complexes and spin columns were used to purify the DNA. PCR was carried out with 40 cycles under the following reaction conditions: 94 °C for 20 s, 59 °C for 30 s, and 72 °C for 30 s, and the reaction volumes were set as 20 µl. Specific PCR primers were synthesized for amplifying target promoter sequences of ChAT gene (M promoter). The primer sequences were as follows: forward, 5′∼3′, CTGTGAGGAAGAGAGGCAGG; reverse, 5′∼3′, GACTGACTGCAAGCAAACCA (Aizawa & Yamamuro, 2010). After amplification, the agarose gel was used to separate the PCR products (10 µl) and then exposed to UV light. The light intensity was detected by densitometry to quantify the DNA content.

Statistical analysis

The statistical data were analyzed by using SPSS 23.0 statistical software (SPSS, Chicago, IL, USA) and expressed as means ±  standard deviation (SD). Statistical differences among different groups were performed using one-way ANOVA followed by multiple-range test. P value of <0.05 was considered to be significant, and p < 0.01 was suggested to be extremely significant.

The Y-maze test revealed the changes of spatial working memory of mice in different groups (n = 10)

The result of the Y-maze test exhibited significantly lower percentage of spontaneous alternations of mice in the TBI+SE group (p < 0.01) as compared to that of the mice in the SHAM+SE group. After living in EE for 4 weeks, the mice in the TBI+EE group showed a significantly increased percentage of spontaneous alternations compared with the mice in TBI+SE (p < 0.05). However, the percentage of spontaneous alternations of TBI+EE group mice was still distinctly differentiated from that of SHAM+SE group mice (p < 0.05), (Fig. 3A). The total number of arms entered between the three groups showed no significant difference (p > 0.05), (Fig. 3B).

EE improves cholinergic system’s function in the prefrontal cortex of contralateral side of TBI

Ach level in the prefrontal cortex (n = 6)

Ach is a critical indication of the function of cholinergic system in the brain (Wang et al., 2016). So, the changes in the Ach levels of the left prefrontal cortex (contralateral side of TBI) after EE intervention were examined. The TBI+SE group mice showed significantly decreased Ach levels in their left prefrontal cortex compared to those of the SHAM+SE group mice (p < 0.01). After living in EE for 4 weeks, the Ach levels of the TBI+EE group mice had a remarkable growth compared with those of the TBI+SE group mice (p < 0.05). However, the TBI+EE group mice still exhibited lower Ach levels than those of the SHAM+SE group mice (p < 0.05), (Fig. 4A).

EE enhances histone acetylation in the prefrontal cortex of contralateral side of TBI (n = 6)

The levels of protein expression of Ac-H3 and Ac-H4 in the tissues are usually used to evaluate the changes in histone acetylation of the organism (Wang et al., 2013; Wang et al., 2016). As shown in Fig. 5, the protein expression of Ac-H3 and Ac-H4 of left prefrontal cortex of the TBI+SE group mice showed significant decrease compared to those of the SHAM+SE group mice (P < 0.01). After living in EE for 4 weeks, the Ac-H3 protein expression of the TBI+EE group mice exhibited a significant rise compared to that of the TBI mice living in the standard environment (P < 0.05). But no changes of Ac-H4 protein expression of the TBI+EE group mice compared with that of the TBI+SE group mice were observed (P > 0.05). The Ac-H3 protein expression of the TBI+EE group mice was still obviously different from that of the sham-operated mice living in the standard environment (p < 0.05).

EE raises CREB binding protein (CBP) expression in the prefrontal cortex of contralateral side of TBI (n = 6)

Next, the changes of protein expression of CBP in the prefrontal cortex of contralateral side of TBI between different groups were observed. The expression levels of CBP in the TBI+SE group mice was decreased significantly compared to those of the SHAM+SE group mice (p < 0.01), (Fig. 6). The TBI+EE group mice showed significantly increased expression levels of CBP compared with those of TBI+SE group mice (p < 0.05). But still a significant reduction in the expression levels of CBP in the TBI+EE group mice compared to those of the SHAM+SE group mice was observed (p < 0.05), (Fig. 6).

EE increases histone acetylation at ChAT gene promoter region in the prefrontal cortex of contralateral side of TBI (n = 6)

According to the previous studies, the transcription of ChAT mRNA was involved in histone acetylation (Aizawa & Yamamuro, 2010; Aizawa, Teramoto & Yamamuro, 2012). Therefore, the changes of histone H3 acetylation of M-type promoter of ChAT gene in the prefrontal cortex of contralateral side of TBI were detected by chromatin immunoprecipitation assay. The results showed that the TBI+SE group mice exhibited an obvious reduction in histone H3 acetylation at ChAT gene M-type promoter region of the left prefrontal cortex compared to that of the sham-operated mice living in the standard environment (p < 0.01), (Fig. 7). After living in EE for 4 weeks, the levels of histone H3 acetylation at ChAT gene M-type promoter region of the prefrontal cortex in the TBI+EE group mice was increased remarkably compared to that of the TBI +SE group mice (p < 0.05). But a significant difference in the level of histone H3 acetylation at ChAT gene M-type promoter region of the TBI+EE group mice compared to that of the SHAM+SE group mice was still observed (p < 0.05) (Fig. 7).