Arbutin increases Caenorhabditis elegans longevity and stress resistance

Chemicals and reagents

Juglone, DCFH-DA and sodium azide were purchased from TransGen Biotech Co., Ltd. (Beijing, China). All other chemicals were of analytical or reagent grade.

C. elegans strains and maintenance

The following strains in this study were obtained from the Caenorhabditis Genetics Center: wild type N2, CF1038 (daf-16 (mu86)I), TJ356 zIs356 (daf-16p::daf-16a/b::GFP+rol-6(su1006)). Worms were maintained at 20 °C on agar plates containing nematode growth medium (NGM, 1.7% agar, 25 mM potassium phosphate, pH 6.0, 50 mM NaCl, 2.5 µg/ml peptone, 5 µg/ml cholesterol, 1 mM MgSO₄, 1 mM CaCl₂) seeded with Escherichia coli OP50. Arbutin (Wuhan Fude Chemical Co., Ltd., Wuhan City, Hubei Province, China; >98% pure, HPLC grade) dissolved in ultrapure water to a concentration of 50 mM and added directly to E. coli OP50 cultured in LB liquid medium supplement present to final concentrations of 0.5, 2.5, 5, 10 and 20 mM.

Lifespan assay

The lifespan assay of C. elegans was investigated as previously described (Schlotterer et al., 2009). The pre-fertile period of adulthood was used as time zero (t = 0). The nematodes were maintained on NGM plates containing either various concentrations of arbutin or vehicle (control) from birth and transferred to new plates every day. Worms were recorded as dead if they did not move after repeated stimulus and they were excluded if they crawled away from the plate. The assays were running until all animals died. Experiments were performed in at least triplicate with 120 nematodes each at 20 °C. All subsequent assays were conducted using the most effective concentration in inducing lifespan extension relative to wild type controls.

Stress resistance assays

Twenty gravid adult nematodes (N2 or CF1038) were placed on NGM plates seeded with E. coli strain OP50 together with no arbutin (control group) or 5 mM arbutin (experimental group). Worms were allowed to lay eggs at 20 °C for approximately 2 h to obtain a synchronous population. Then, they were removed and the plates were placed back at 20 °C until the progeny reached young adulthood (about 72 h). Worms were transferred to fresh control plates or arbutin plates every day. On the fifth day (at about 120 h), animals were submitted to various kinds of stressors. Experiments were performed in triplicate, with 60 nematodes each at least.

In the heat shock stress assay, animals were transferred from 20 °C to 35 °C incubator and the number of surviving worms were recorded every hour until all worms died. In the juglone stress assay, worms were placed in 96-well plates containing 200 µl S medium (100 mM NaCl, 0.01 mM cholesterol and 50 mM potassium phosphate, pH 6.0) with 200 µM juglone in each well (Waterston & Brenner, 1978). Worms were observed at 20 °C every hour until no worms remained alive. In the UV-irradiation stress assay, worms were treated with 254 nm UVC irradiation with a dose of 1,000 J/m² for 8 min 40 s and immediately transferred to 20 °C incubator. Animals were counted every 12 h until they died.

Measurement of general ROS levels

Five-day-old worms with or without 5 mM arbutin treatment from birth were transferred into 100 µl M9 buffer (22 mM KH₂PO₄, 42 mM Na₂HPO₄, 85 mM NaCl, 1 mM MgSO₄) with 200 µM DCFH-DA. After incubation with DCFH-DA for 2 h, animals were washed with M9 buffer to remove residual DCFH-DA. And then they were transferred to 96-well plates containing 200 µl M9 buffer per well. ROS-associated fluorescence levels were measured using a fluorescence microplate reader (Infinite F200 PRO, Tecan, Switzerland) at 485 nm excitation and 535 nm emission settings. Arbutin-treated group relative fluorescence unit (RFU) was compared with control group of which mean value RFU was set as 1 to reflect relative ROS levels. Ten worms were added to each well and at least twenty parallel wells were performed for each group (control or 5 mM arbutin treatment).

Fluorescence quantification of DAF-16::GFP

Transgenic strains TJ356 worms harboring the DAF-16::GFP reporter gene were subjected to arbutin treatments from birth to 5 days of age. Then, they were treated with 35 °C heat shock for 30 min. Later, animals were narcotized with 10 µM sodium azide and fixed to glass slides containing 5% agar for observation under a fluorescence microscope. DAF-16 expression corresponded with green fluorescence intensity. Experiments were performed in at least triplicate, with 10 nematodes each.

Quantitative real-time PCR

After birth followed by 5 days of incubation either with or without 5 mM arbutin, worms were collected and washed with M9 buffer to remove residual E. coli OP50 on their skin. Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used for total RNA extraction. The primers used in RT-PCR were as follows: daf-16, 5′-TTTCCGTCCCCGAACTCAA-3′ and 5′-ATTCGCCAACCCATGATGG-3′; sod-3, 5′-AGCATCATGCCACCTACGTGA-3′ and 5′-CACCACCATTGAATTTCAGCG-3′; hsp-16.2, 5′- CTGCAGAATCTCTCCATCTGAGTC -3′ and 5′-AGATTCGAAGCAACTGCACC -3′; ama-1, 5′-CTGACCCAAAGAACACGGTGA-3′ and 5′-TCCAATTCGATCCGAAGAAGC-3′. The gene ama-1 was used as an internal reference gene and the AB 7500 RT-PCR (Applied Biosystems, Foster City, CA, USA) detection system was used to visualize RT-PCR products. RT-PCR data were analyzed using the comparative 2^−△△Ct method (Livak & Schmittgen, 2001). Experiments were performed in at least triplicate, with 200 nematodes per group for total RNA extraction.

Brood size

Animals synchronized at the first larval stage were grown on NGM/OP50 plates with or without 5 mM arbutin. On the second day, animals were separated to relevant plates with one animal per plate and then they were transferred every 24 h to fresh control or 5 mM arbutin plates until cessation of egg production. The total number of progeny from each animal was counted and the number of progeny for each group was averaged (Li et al., 2008). Experiments were performed in triplicate, with 10 nematodes each.

Statistical analysis

The data from lifespan of control and arbutin-treated worms (N2 and CF1038) under normal and stress conditions were determined using the Kaplan–Meier survival assay in Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA) and statistical significance was analyzed by log-rank (Mantel-cox) test. Data other than lifespan were statistically analyzed using one-way analysis of variance (ANOVA). Results were expressed as the mean ± standard error of the mean (SEM). P-values <0.05 were taken as statistically significant (0.01 ≤ * p < 0.05, 0.001 ≤ ** p < 0.01, *** p < 0.001).

Arbutin extends lifespan of C. elegans under normal culture conditions

Low concentrations of arbutin showed dose-related lifespan-extending effects, with the maximum effect observed at 5 mM (extending worm average lifespan by 11.89%), whereas 10 mM and 20 mM arbutin exhibited toxicity. It is certain that arbutin significantly extended lifespan of nematodes in a suitable concentration. We performed additional experiments using 5 mM arbutin to further test its protective effects on worms under various types of stressors (Fig. 1, p < 0.0001).

Arbutin improves worms’ survival under stress

Heat stress

The survival rate of animals pretreated with 5 mM arbutin from birth to 120 h of age had significantly increased relative to the control under 35 °C stress. Results demonstrated that arbutin could enhance resistance to heat shock in C. elegans (Fig. 2A, p < 0.05).

Arbutin reduces the ROS levels

It is known that excessive free radical accumulation may harm organisms. Because oxygen, an electron receptor, may promote the formation and accumulation of ROS and cellular respiration is one of the chief causes of oxidative damage in aerobic organisms. Meanwhile, newly generated free radicals, such as superoxide anions, hydrogen peroxide and hydroxyl radicals, are immediately eliminated by antioxidant enzyme systems (Harman, 1956). Therefore, we studied whether the longevity effect of arbutin on worms was associated with ROS scavenging ability. While ROS level was usually higher during a stress response, it was significantly decreased in worms treated with arbutin compared with control. We therefore suggested that arbutin might act as an antioxidant by scavenging free radicals, ultimately extending C. elegans lifespan and improving resistance to environment stress (Fig. 3, p < 0.001).

Arbutin has no effect on the resistance to stress of daf-16 mutant worms

DAF-16 is a major transcription factor which modulates longevity and stress resistance in C. elegans (Murphy et al., 2003). We examined the lifespan of daf-16 mutants CF1038 under stress. We found that there was no difference between lifespan of 5 mM arbutin treated and untreated mutant CF1038 under three kinds of stressors (heat shock, juglone and UV-irradiation), indicating that arbutin acting on animals was related to daf-16 (Figs. 4A–4C, p > 0.05).

Arbutin improves DAF-16::GFP nuclear localization in TJ356 worms

The nuclear localization of DAF-16 is essential for its transcriptional activity. Thus, we conjectured that arbutin could also positively regulate DAF-16 expression in nuclear. Here, we employed a transgenic strain TJ356 which expressed DAF-16::GFP (Lee, Hench & Ruvkun, 2001) reporter to quantitatively visualize DAF-16 expression through a fluorescence microscope. After 35 °C heat shock for 30 min, 5 mM arbutin-treated worms displayed a significantly increased fluorescence intensity compared with the control group. These results suggested that arbutin might also activate antioxidant-related signaling pathways that ultimately led to improve DAF-16 nuclear localization for increasing resistance to oxidative stress (Figs. 5A–5C, p < 0.001).

Arbutin promotes relative mRNA levels of daf-16 and it downstream genes sod-3 and hsp-16.2

To further investigate whether working mechanism of arbutin was regulated by DAF-16 and its target proteins, we measured mRNA levels of daf-16, sod-3 and hsp-16.2 in N2 worms treated with or without 5 mM arbutin. It is known that protein activities which are dependent on DAF-16-related transcriptional regulation are generally recognized as important in stress response and longevity (Heidler et al., 2010). As expected, daf-16 (p < 0.001) and its downstream targets sod-3 (p < 0.05) and hsp-16.2 (p < 0.001) were all up-regulated with arbutin treatment relative to the control. Therefore, the results demonstrated that DAF-16 was vital to arbutin’s positive effect on lifespan and stress resistance in C. elegans (Figs. 6A–6C).

Arbutin does not affect brood size in C. elegans

An increase in lifespan is often correlated with a decrease in fecundity (Wang et al., 2017). To test whether arbutin adversely affected fecundity, we measured brood size for ten N2 animals in each group treated with either 0 mM (control) or 5 mM arbutin. The results showed that there was no significant difference between treatment group and control (Fig. 7, p > 0.05).