Analysis of the resistance level and target site resistance mechanisms of Echinochloa crus-galli to penoxsulam from Hubei Province, China

Plant materials

Seeds of 15 E. crus-galli populations were collected from rice fields in Hubei Province during the 2018 growing season (Table 1 and Fig. 1). The collection was approved by the research council of the Institution of Plant Protection and Soil Fertilizer, Hubei Academy of Agricultural Sciences, with approval number 201805. The susceptible population 18-NJ was provided by the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences. All seeds were randomly collected from mature barnyardgrass plants. At least 300 individual plants were sampled at each collection point. The plant morphology and phylogenetic relationships determined by Amplified Fragment Length Polymorphism (AFLP) fingerprinting of these populations are described in detail elsewhere. The seeds were subsequently placed in a cool, dry place at room temperature (20–22 °C) to air dry and then stored in a low-temperature (1–5 °C) and low-humidity (below 50%) seed cabinet until use. The original collected populations were used for the herbicide dose–response experiments. Seeds from the resistant populations were selected with penoxsulam in a controlled greenhouse for an additional generation (F1 generation) through self-pollination.

Plant growth conditions and herbicide application

Prior to germination, the seeds were treated with 100 mg/L gibberellic acid solution for 24 h at room temperature (20–22 °C), followed by germination in a dark incubator at 28 °C for 48 h. The germinated seedlings at the Biologische Bundesanstalt, Bundessortenamt und CHemische Industrie (BBCH) 11–12 (1–2 leaf stage) were subsequently transplanted into plastic pots (15 cm in diameter and 12 cm in height) and covered with 0.2 cm thick growth medium. The growth medium in each pot consisted of vermiculite and an organic matter mixture at a 1:1 (w/w) ratio, with each pot accommodating 30 seedlings. The pots were subsequently transferred into a growth chamber set at a temperature of 30/25 °C, with a light/dark cycle of 14/10 h, a light intensity of 12,000 lx, and a relative humidity of 60%. Before herbicide treatment, the seedlings in each pot were thinned to 20 plants whose growth was consistent. Seedlings from each population were treated with different doses of penoxsulam at BBCH 12–13 (2–3 leaf stage) by using a sprayer chamber equipped with a TeeJet^® XR8002 flat fan nozzle with a spraying volume of 450 L ha⁻¹ at 0.3 MPa.

Whole-plant dose response to penoxsulam

Based on the recommended field dose of 30 g a.i. ha⁻¹ penoxsulam in the rice field, penoxsulam doses of 1, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1,024, and 2,048 g a.i. ha⁻¹ were applied to the putative resistant populations, and doses of 0.25, 0.5, 1, 2, 4, 8, 16, and 32 g a.i. ha⁻¹ were applied to the susceptible population. After herbicide treatment, the seedlings were transferred into a greenhouse with natural light, a temperature of 30/25 °C and a relative humidity of 60%. The whole experiment was conducted during the barnyardgrass growing season, which was from April to October. The aboveground fresh biomass weight of the plants was recorded at 21 days after herbicide treatment. Four replicates were performed for each herbicide dose, and the experiments were conducted twice.

ALS gene cloning and sequencing

At least 10 surviving individual plants from the different dose–response treatments of each population were collected for gene identification. Approximately 100 mg of shoot tissue was used for genomic DNA extraction. Genomic DNA extraction was conducted by using a NuClean Plant Genomic DNA Kit (CWBIO, Jiangsu, China) according to the manufacturer’s instructions. A specific primer pair (ALS-S: CTCCTTGCCACCCTCCCC and ALS-R: CTGCCATCACCATCCAGGATC) was designed on the basis of the ALS sequences (ALS1: LC006058.1, ALS2: LC006059.1, ALS3: LC006061.1) (Fig. S1). The polymerase chain reaction (PCR) amplification was performed with two µl of DNA template, two µl (10 µM) of each primer, 25 µl of 2 ×Phanta Max Buffer (Vazyme Biotech, Nanjing, China), 0.5 µl of dNTP Mix, one µl of Phanta Max Super-Fidelity DNA Polymerase (Vazyme Biotech, Nanjing, China), and ddH₂O to a final volume of 50 µl. The PCR program was set as follows: one cycle of 94 °C DNA denaturation for 3 min; 35 cycles of denaturation at 94 °C for 60 s, annealing at 63 °C for 50 s, and elongation at 72 °C for 120 s; and a final 72 °C DNA elongation for 10 min. The 2,000 bp PCR products were purified using a Cycle-Pure Kit (Omega Bio-Tek, Guangzhou, China) and cloned and inserted into a pTOPO vector (Genesand Biotech, Beijing, China). The plasmids containing the fragment insertions were transformed into DH5α chemically competent cells and sequenced by Tsingke Biotechnology (Wuhan, China). At least 10 transformed clones of each plant were sequenced to obtain ALS gene sequences. All the sequences were then compared via DNAMAN v.6 software (Lynnon Biosoft, Quebec, Canada) and the Basic Local Alignment Search Tool (BLAST) with the NCBI database to verify the gene copy and gene mutation sites.

In Vitro ALS enzyme activity assay

The S populations (18-NJ) and F1 generation surviving plants of three R populations (18-ETF, 18-WMJ, and 18-WJJ) were used for further ALS enzyme activity assays. Twenty seedlings from each population were transplanted into pots and maintained in a greenhouse until they reached the three-leaf stage. Three grams of leaf tissue from each population was freshly harvested, snap-frozen in liquid nitrogen, and stored at −80 °C until use.

The protocol for the ALS enzyme extraction and assay followed the procedure of Yu et al. (2010) with modifications. The frozen tissue was homogenized with a mortar and pestle and suspended in four volumes of extraction buffer (one mM sodium pyruvate, 0.1 M potassium phosphate (KH₂PO4/K₂HPO₄), 0.5 mM MgCl₂, 10 µM flavin adenine dinucleotide (FAD), 100 mL/L glycerol, and 0.5 mM thiamine pyrophosphate (TPP) at pH 7.5). The mixtures were stirred for 5 min, and the homogenate was filtered through one layer of Miracloth into Polyallomer centrifuge tubes (Beckman Coulter, USA). The samples were subsequently centrifuged for 20 min at 4 °C at 27,000 × g. The supernatants were transferred to beakers, and ammonium sulfate [(NH₄)₂SO₄] was added at 0.313 g/mL supernatant. The supernatant and ammonium sulfate mixtures were stirred at low speed for 20 min to allow protein precipitation. The mixtures were again centrifuged at 4 °C for 20 min at 27,000 × g. The supernatants were discarded, and the pellet was resuspended in 0.5 mL of extraction buffer and desalted on a Sephadex G25 column (Sigma–Aldrich, USA). Thirty-five microliters of the desalted enzyme extract was immediately added to 35 µl of the assay buffer (0.17 M sodium pyruvate, 83.4 mM potassium phosphate (KH₂PO₄/K₂HPO₄), 16.7 mM MgCl₂, 1.7 mM TPP, and 0.167 mM FAD at a pH of 7) and seven µl of a range of penoxsulam concentrations (0.01, 0.1, 1, 10, 100, and 1,000 µmol/L). The reactions were incubated at 37 °C in the dark for 60 min. The reaction was terminated by adding 17.5 µL of 6 N H₂SO₄, followed by incubation at 60 °C for 15 min. Subsequently, 87.5 µL of creatine solution (0.55% w/v) and 87.5 µL of α-naphthol solution (5.5% w/v in 5 N NaOH) were added, and the mixture was incubated at 60 °C for an additional 15 min. Enzyme activity, determined as acetoin formation, was measured colorimetrically at 530 nm. The Bradford method was used to measure the protein concentration in the crude extract (Yu et al., 2004). The experiment included three biological replicates and two technical repeats.

ALS gene expression

The S populations (18-NJ) and F1 generation of three R populations (18-ETF, 18-WMJ, and 18-WJJ) were included in the analyses. Forty seedlings from each population were separately planted and maintained in a greenhouse until they reached the three-leaf stage. The plants of each population were sprayed with penoxsulam at 15 g a.i. ha⁻¹. Approximately 100 mg of leaf tissue from each population was collected from nontreated (NT) plants and treated (T) plants at 1, 3, 5, and 7 days after herbicide treatment.

Total RNA was extracted using a TRIzol total RNA extraction kit (Genstone Biotech, Beijing, China). cDNA was prepared from total RNA using 5 × All-In-One RT master mix (Applied Biological Materials, Richmond, Canada). Quantitative reverse transcription PCR (RT–qPCR) was performed, and the results were analyzed with a Bio-Rad CFX Connect Real Time system using iTaq™ Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). The primer pair QALS-F:5′-ATCCGCATTGAGAACCTCC-3′ and QALS-R:5′-TCTTCTTGATTGCTGCACGT-3′ was used to amplify the ALS genes, and the β-actin gene was used as the endogenous reference gene with the primer pair ACT-F: 5′-CACACTGGTGTCATGGTAGG-3′ and ACT-R: 5′-AGAAAGTGTGATGCCAGAT-3′. The PCR conditions consisted of denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s. The relative quantification of each transcript was calculated following the 2^−ΔΔCt method (Livak & Schmittgen, 2001). All the qPCR assays were conducted with technical triplicates for each sample, and the experiment was repeated twice.

Statistical analysis

All analyses were performed in a completely randomized design. The data were subjected to analysis of variance (ANOVA), and the mean differences were compared by the least significant difference (LSD) test. Data from repeated experiments were pooled for analysis, and inspection of the error distributions suggested that the assumption of normality held reasonably well.

The GR₅₀ (dose at which there was a 50% reduction in growth biomass) and IC₅₀ (herbicide concentration leading to 50% inhibition of ALS activity) were subjected to a nonlinear log–logistic regression model using SigmaPlot (SigmaPlot Software, Chicago, IL, USA) version 14.0 (Seefeldt, Jensen & Fuerst, 1995): ${\displaystyle \mathrm{Y}=\mathrm{C}+\frac{\mathrm{D}-\mathrm{C}}{1+{\left(\mathrm{x}/\mathrm{g}\right)}^{\mathrm{b}}}.}$

In the equation, C represents the lower limit, D represents the upper limit, b represents the slope of the curve, and g represents the GR₅₀ or IC₅₀, where Y is the percentage of the control at herbicide dose or concentration X.

Resistance indexes (RIs) were calculated by dividing the GR₅₀ or IC₅₀ of the resistant population by that of the susceptible population.

Resistance levels to ALS inhibitors

The resistance levels of 15 E. crus-galli populations collected from rice fields in Hubei Province were surveyed (Fig. 2). Among the 15 populations, three populations presented high resistance levels to the ALS inhibitor penoxsulam, and the RIs of these three high-level resistant populations were all more than 100-fold greater than those of the susceptible population. The three high-level resistant populations (18-ETF, 18-DDX, and 18-WLH) were not injured by the recommended dose and exhibited more than 90% growth relative to untreated controls. The GR₅₀ values of these three populations were 750.75, 153.13, and 56.02 g a.i. ha⁻¹, respectively. Moreover, eight populations presented moderate resistance to penoxsulam. The RIs ranged from 10.09 to 50.60. The twelve populations (18-WMJ, 18-WJJ, 18-JPX, 18-QZW, 18-JJCY, 18-YTW, 18-HDD, 18-XYCZ, 18-JWZ, 19-JZWD, 18-XYXS, and 18-JJXJ) that presented moderate and low resistance levels partially survived under the recommended dose of penoxsulam and presented different physiological effects, such as curling leaves or shortened growth. The GR₅₀ values of these populations ranged from 2.88 to 24.37 g a.i. ha⁻¹ (Table 2).

Sequence analysis of the genes encoding ALS enzymes

The ALS genes of ten individual plants from each of the 15 resistant populations were amplified and subsequently analyzed by the NCBI BLAST server for individual searches. The sequencing results were compared and distinguished from the full-length sequences of ALS1, ALS2, and ALS3 in the susceptible population by DNAMAN. Among the 15 resistant populations, ten populations (18-ETF, 18-DDX, 18-WLH, 18-WMJ, 18-WJJ, 18-QZW, 18-JPX, 18-YTW, 18-HDD, and 18-XYCZ) included individuals harboring the known resistance mutation Trp-574-Leu. However, the mutated genes were not the same. 18-ETF and 18-DDX had mutations in ALS3, and 18-WLH, 18-WJJ, 18-QZW, 18-YTW, and 18-HDD had mutations in ALS2, which accounted for the largest proportion of Trp-574-Leu ALS mutations, whereas 18-WMJ, 18-JPX, and 18-XYCZ had mutations in ALS1. Interestingly, a Pro-197-Leu substitution occurred in the 18-JJCY population. Although previous studies revealed that the Pro-197-Leu mutation is the target site basis for resistance to ALS-inhibiting herbicides in other weeds, this was the first time that the Pro-197-Leu mutation was found in E. crus-galli. However, none of the mutants confer resistance to known Ala-122, Ala-205, Phe-206, Asp-376, and Ser-653 sites, which have been reported in other Echinochloa species. In addition, four populations (18-JWZ, 18-JZWD, 18-XYXS, and 18-JJXJ) had surviving plants without any mutations in ALS genes, which suggested that non-target-site mechanisms may exist in these populations. More physiological and chemical analyses will be conducted to confirm this hypothesis (Table 3).

In Vitro ALS enzyme activity

The F1 generations of surviving resistant plants from the 18-ETF, 18-WMJ, 18-WJJ, and 18-NJ populations were selected for further in vitro ALS enzyme activity assays. The total ALS activity levels measured in the resistant populations 18-ETF, 18-WMJ, and 18-WJJ were greater than those in the sensitive population, suggesting that the catalytic activity of the mutant enzyme changed (Table 4). Moreover, the IC₅₀ values for 18-ETF, 18-WMJ, and 18-WJJ were 63.07, 6.78, and 10.41 µM, respectively, which were 51.28-, 5.51-, and 8.46-fold greater than those of the susceptible population 18-NJ (1.23 µM) (Fig. 3). The results indicated that the Trp-574-Leu mutation could affect the conjunction of penoxsulam, which resulted in reduced sensitivity to ALS in these three E. crus-galli populations. In addition, this trend was not completely consistent with the whole-plant dose–response analysis, in which the IC₅₀ value for 18-WMJ was lower than that for 18-WJJ. This may be related to different ALS gene mutations and mutation frequencies. Although a slight difference in in vitro enzyme activity was detected, the results supported the hypothesis that a TSR mechanism was responsible for the resistance of the E. crus-galli 18-ETF, 18-WMJ, and 18-WJJ populations.

ALS gene expression

ALS gene expression analysis was conducted in the R populations 18-ETF, 18-WJJ, 18-WMJ and S population 18-NJ. In the absence of penoxsulam treatment, the basal expression levels of ALS in the three R populations were 1.53-, 1.58-, and 1.41-fold greater than those in the S population. However, after penoxsulam treatment, the ALS expression in the R and S populations significantly increased, indicating that the ALS gene was induced by penoxsulam. Compared with the S population 18-NJ, 18-WJJ and 18-WMJ presented the same ALS expression pattern. 18-WJJ and 18-WMJ exhibited the highest degree of induced ALS expression, with 8.72- and 7.19-fold changes at 24 h post-treatment. Subsequently, ALS gene expression in these two populations decreased and was lower than in the S population 18-NJ. Unlike the 18-WJJ and 18-WMJ populations, the ALS gene expression of 18-ETF presented another pattern, with the highest ALS gene expression (6.93-fold) occurring three days after treatment (Fig. 4). The different gene expression patterns may be caused by distinct mutation sites. Furthermore, NTSR may also play an important role in penoxsulam absorption and transduction, which could explain the differential expression patterns observed among populations.