Genome-wide identification, expression pattern and interacting protein analysis of INDETERMINATE DOMAIN (IDD) gene family in Phalaenopsis equestris

Identification of IDDs in P. equestris and phylogenetic analysis

The P.equestris genome sequence and annotation file were download from the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/genome/?term=txid78828[orgn]&shouldredirect=false). AtIDD and OsIDD proteins were downloaded from The Arabidopsis Information Resource (TAIR) database (https://www.arabidopsis.org) and The Rice Genome Annotation Project Database and Resource (http://rice.uga.edu/index.shtml) (Table S1), respectively. To identifiy potential IDDs in P. equestris, 16 AtIDD and 15 OsIDD proteins were used as query sequences in a BLAST search with default parameters in TBtools v1.120 software (Chen et al., 2020). In addition, all candidate PeIDD proteins were verified according to the method of previous report (Jiang et al., 2022) to confirm IDD domains. Incomplete and redundant protein sequences were discarded manually. Subsequently, physicochemical properties (PIs, MWs) were predicted through the ExPASy website (https://www.expasy.org/).

Multiple sequence alignment of IDD proteins from Oryza sativa, A. thaliana and P. equestris was done using ClustalX 2.0 software (Larkin et al., 2007). The sequence alignment results were used to construct the neighbor-joining (NJ) tree by MEGA 7.0 software (Kumar, Stecher & Tamura, 2016), with the following parameters: Poisson correction, complete deletion, and bootstrap (1,000 replicates).

Gene structures analysis, conserved motifs prediction, and cis-element analysis of the promoters

The gene structures of PeIDDs were determined by DNA and cDNA sequence alignment. The potentially conserved motifs of PeIDD proteins, including ID domain, were determined by the online Multiple Expectation for Motif Elicitation (MEME, http://meme-suite.org), (Bailey et al., 2009), using the following parameter settings: the maximum number of motifs, 10; the minimum width of motifs, 5; the maximum width of motifs, 20; and other default parameters. The promoter sequences of PeIDDs were harvested from NCBI website and its cis-acting elements were predicted using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (Lescot et al., 2002). All gene structures, conserved motifs, and cis-elements were visualized by running the IBS version 1.0.2 software (Liu et al., 2015).

Protein interaction prediction

The online STRING platform (https://string-db.org) (Szklarczyk et al., 2017) was used to predict the protein-protein network between PeIDDs and other proteins, using Dendrobium catenatum as reference organism, with the parameter: predicted interacting protein score above 0.4.

Plant materials, RNA extraction and qRT-PCR

Fifteen P. equestris was collected from Lufa Orchid (Taiwan, China) and placed in the greenhouse of Jingchu University of Technology. Roots, leaves, flowers, and floral stalks were sampled and immediately stored at −80 °C. For plant hormone and stress treatment, the plants were exposed to 0.2 M ABA, 10⁻⁶M NAA, 20% PEG6000, and 4 °C. Total RNA from different tissues was isolated by TransZol (ET101-01-V2; TransGen Biotech Co., Ltd., Beijing, China) reagent, and detected by NANODROP 1,000 spectrophotometer to determine the extraction quality, then reversed transcribed into cDNA with HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01; Vazyme, Hangzhou, China) following the manufacturer’s instructions. The cDNA was diluted to 100 ng/µL and used as a template for RT-qPCR. Specific primers for 10 PeIDD genes with amplified size ranging from 170 to 250 bp were designed using online programs (https://sg.idtdna.com/scitools/Applications/RealTimePCR/) (Table S2). The RT-qPCR was performed on the QuantStudio 6 Flexreal-time PCR instrument (Applied Biosystems, Foster City, CA, USA). PeActin was used as an internal reference (F: GCTGAGGGAGGCAAGGATAGAT; R: GCACCCAGCAGCATGAAGATC) to standardize gene expression levels, and each cDNA was subjected to three biological replicates. The PCR mixture (10 µL) included 5 µL Taq Pro Universal SYBR qPCR Master Mix (Q712-02; Vazyme, Hangzhou, China), 10 mM of each primer, 100 ng cDNA template, and nuclease-free water. The PCR program was performed as follows: 95 °C for 10s; 40 cycles of 95 °C for 5 s, 60 °C for 40 s. Relative expression values were calculated using the 2^−ΔΔCt method (Livak & Schmittgen, 2001) and visualized by GraphPad Prism 8.0.2.

Genome-wide identification and characterization of PeIDD gene family

Using 16 AtIDD and 15 OsIDD protein sequences as the queries, 12 PeIDD proteins were initially identified by BLAST searches. Examined by ID domains, ten proteins were finally confirmed as PeIDD family members. According to the order distribution on the scaffolds (Fig. S1), these genes werer named PeIDD1-PeIDD10. The analysis of these PeIDD protein sequences (Table S3) revealed that the physicochemical properties of each member were different (Table S4). The amino acid lengths of the PeIDDs ranged from 197 aa (PeIDD3) to 480 aa (PeIDD1). The molecular weight (MW) ranged from 22,098.33 Da (PeIDD3) to 50,799.25 Da (PeIDD1). The isoelectric point (pI) of PeIDDs ranged from 8.71 (PeIDD10) to 9.56 (PeIDD3). The instability index spanned from 37.79 (PeIDD8) to 89.71 (PeIDD3).

Phylogenetic analysis of PeIDDs

To better understand the phylogenetic relationship of IDDs in A. thaliana (16 members), O. sativa (15 members) and P. equestris (10 members), a neighbor-joining (NJ) tree of 41 IDD proteins was constructed based on their full length amino acid sequences. All IDD proteins were clearly divided into two groups (I and II) (Fig. 1). Group I had a large number of member, with 13 AtIDDs, 12 OsIDDs, and 8 PeIDDs, accounting for 80.5% of the total IDD proteins. While group II only harbored 8 IDD proteins (three AtIDDs, three OsIDDs, and two PeIDDs). On the basis of the bootstrap values and topological structure, group I can be divided into four subgroups. Interesting, subgroup I-2 were solely composed of AtIDDs and OsIDDs. In other subgroups of group I (subgroup I-1, I-3, and I-4), most PeIDDs were clustered with OsIDDs firstly, suggesting that PeIDDs might have a close relationship to OsIDDs.

Gene structure and motif composition of PeIDD gene family

To gain more insight into the potential relationship about gene structure-function and protein structure-function, gene structure and motif prediction of PeIDDs were determined. For the exon-intron structures, most PeIDDs displayed three exons, whereas PeIDD1 and PeIDD7 had four and two exons, respectively (Fig. 2A). The length of exons was similar, while the intron lengths varied greatly (Fig. 2A). In particular, PeIDD6 and PeIDD7 had exceptionally long introns, which was similar to the KNOX gene structure of orchids and might be unique to Orchidaceae (Zhang et al., 2022). In P.equestris genome, half of PeIDDs (PeIDD3, PeIDD4, PeIDD6, PeIDD8 and PeIDD10) had no 5′-UTR, 3′-UTR, and both UTRs (5′-UTR and 3′-UTR) (Fig. 2A). This suggested that they were likely the UTR-less IDD genes in P. equestris.

Subsequently, MEME (http://meme-suite.org) was used to predict the putative motifs shared among PeIDD proteins. In total, 8 types of motifs were observed (Fig. 2B, Fig. S2). Motif 2, 3, 4, and 5 were widespread at the N-terminus of all PeIDDs. Motif 2 encoded a nuclear localization signal (NLS), indicating that all PeIDDs are located in the nucleus. Motif 3, 4, and 5 constituted the conserved ID domain, which was the unique structure of IDDs. Motif 1 was specific to the PeIDDs (PeIDD2, PeIDD4, and PeIDD9) of subgroup I-1 (Fig. 1). Motif 6, following the ID domain, only existed in PeIDD1, PeIDD2, PeIDD4, and PeIDD9. Motif 7 (“MSATALLQKAA” domain) and motif 8 (“TRDFLG” domain) that were verified to act in protein-protein interactions (Colasanti et al., 2006) were found in the C terminus of most PeIDDs. Because motifs are associated with protein interactions or binding to target genes, differences in motif composition suggest that these PeIDDs may function in different mechanisms.

Cis-regulatory elements analysis of PeIDD genes

In order to a space between the two words in the promoter regions of PeIDDs, 2,000 bp sequences upstream of transcription start site of PeIDDs were retrieved as the promoters (Table S5), and then submitted them to the PlantCARE database. A large number of cis-elements were obtained and could be classified into three types: growth and development-related, phytohormone responsive, and abiotic stress responsive (Table S6). Growth and development-related elements consisted of LRE (light responsive element), SSE (seed-specific regulation element), MEE (meristem expression element), PEE (palisade mesophyll cells expression element), and EEE (endosperm expression element). Hormone responsive elements included ABA, GA, Auxin, SA, and MeJA. Abiotic stresses responsive elements were low-temperature responsive element and drought-related element (Fig. 3).

Among these growth and development-related cis-elements, LREs were the most frequently occurring responsive elements, suggesting that PeIDDs might play important roles in P. equestris light morphogenesis. Plant hormones are also essential to plant growth and development. ABA-responsive elements (ABRE) and Auxin-responsive elements (TGA-element, AuxRR-core) were observed in nine PeIDDs. SA responsive elements (TCA-element) and MeJA responsive elements (TGACG-motif, CGTCA-motif) existed in seven PeIDDs. GA responsive elements (P-box, TATC-box, GRAE-motif) were found in five PeIDDs. The widespread distribution of hormone response elements in the promoter indicated that PeIDDs might be widely involved in hormone signal pathway.

The adaptability to the environment is a focus in plant breeding. Two cis-elements related to abiotic stress, namely, drought response element (LTR) and low temperature response element (DE), appeared in the promoter of PeIDDs. DE existed in seven PeIDDs, and LTR was present in six PeIDDs. These results suggested that PeIDDs might play a vital role in stress adaptation.

Expression patterns of PeIDD genes in different tissues

The tissue-specific expression patterns of the PeIDD gene family were investigated in four tissues/organs, including root, flower, leaf, and floral stalk. The results revealed that the PeIDDs exhibited different expression level in these tissues. Seven PeIDDs (PeIDD2, PeIDD4, PeIDD5, PeIDD6, PeIDD7, PeIDD9, and PeIDD10) showed high transcripts in vegetative tissues (root and leaf), but relatively low expression levels in the reproductive tissue (flower and floral stalk) (Fig. 4). Among them, PeIDD5 was predominantly expressed in leaf (Fig. 4), hinting PeIDD5 might participate in leaf development. PeIDD9 and PeIDD10 were highly expressed in the root, especially PeIDD10 was expressed specifically in the root and barely detected in other tissues (Fig. 4), indicating PeIDD9 and PeIDD10 might regulate root development. The transcript levels of PeIDD1, PeIDD3, and PeIDD8 displayed higher expression in floral stalk and flower (Fig. 4), suggesting they might be involved in flower development.

Response of PeIDD genes to plant hormones and abiotic stress

Because of lots of hormone and stress responsive elements were found in the promoter of PeIDDs, the expression patterns of PeIDDs under hormones (ABA and NAA) and stresses (drought and cold) during the different time courses (0 h, 1 h, 5 h, and 10 h) were analyzed by RT-qPCR. Under 0.2 M ABA treatment, seven PeIDDs (except PeIDD3, PeIDD7, and PeIDD10) expression levels reached their peaks after 1 h or 5 h. PeIDD7 was induced at 1 h and peaked after 10 h, while PeIDD3 showed no significant changes and the expression of PeIDD10 was inhibited (Fig. 5). After NAA treatment 1 h, PeIDD1, PeIDD4 and PeIDD9 transcripts had a significant decline compared with the untreated group, while the expression levels of PeIDD2, PeIDD5, PeIDD6, and PeIDD7 showed an over two-fold increase. PeIDD8 was obviously upregulated after NAA treatment 5 h (Fig. 5).

Regardless of whether PeIDDs had drought responsive elements or not (Fig. 3, Table S4), all PeIDDs responded to drought at different time points. Nine PeIDDs showed at least two-fold increase of transcripts, while PeIDD4 exhibited down-regulation of transcript level. The results revealed that PeIDDs might be widely involved in drought response. Under cold treatment, these results were related to the number of LTRs in the promoter of PeIDDs (Fig. 3, Table S4). For example, four PeIDDs (PeIDD7, PeIDD8, PeIDD9, and PeIDD10) contained two or three LTRs and showed obvious induced expression (Fig. 6), among which the expression of PeIDD 8 increased more than 8-fold after 1 h of treatment. PeIDD2 and PeIDD3 had one LTR and exhibited a slight increase in expression. However, PeIDD1, PeIDD4, PeIDD5, and PeIDD6 had no LTR elements, their expression level was down-regulated after cold stress (Fig. 6), which suggested that they might be regulated indirectly or had other unknown cold responsive elements.

Prediction of protein interaction network of PeIDD proteins

Although the function of PeIDDs has not been reported, understanding the protein–protein interaction (PPI) network may help us understand their regulatory mechanism. Based on the prediction results from the STRING website (Table S5), the interaction network was constructed by Cytoscape software. The results showed PeIDDs could interact with 21 proteins, including TFs (5), chromatin remodeling factors (4), enzymes (2), and other proteins (10) (Fig. 7, Table S5). Among TFs, ERF021 and TINY are ethylene responsive factors (Xie et al., 2019). PeIDD2 and PeIDD10 could interact with ERF021 and PeIDD4 with TINY, suggesting that the three PeIDDs might be integrated into the ethylene response pathway. WRKY family is known to involve in biotic and abiotic stress response (Wani et al., 2021; Khoso et al., 2022). WRKY24 was predicted to interact with PeIDD4 and PeIDD9, indicating PeIDD4 and PeIDD9 might participate in stress adaptation. PTI5 is a pathogenesis-related transcriptional activator (Wang et al., 2021). PeIDD5 might be involved in plant immune response by interacting with PTI5. Among chromatin remodeling factors, SWI/SNF (SWITCH/SUCROSE NONFERMENTING) was reported to regulate chromatin structure (Bieluszewski et al., 2023). PeIDD3 and PeIDD5 were predicted to act with SWI3 subunit, indicating PeIDD3 and PeIDD5 might regulate transcript levels of their target genes by recruiting chromatin remodeling factors. The interaction of PeIDD8 to SMC3 (structural maintenance of chromosomes protein 3) indicated that PeIDD8 might help to stabilize chromosome structure. ATP-dependent helicase BRM is one of the enzymes that PeIDDs bound. Its interaction protein PeIDD5 might help it locate to specific chromatin regions. Dehydration-responsive element-binding protein (DREB) and the SHR-SCR (SHORTROOT-SCARECROW) complex stood out among the other proteins. PeIDD2, PeIDD4, PeIDD9, and PeIDD10 could interact with DREB, indicating that they could participate in drought responses. SHR-SCR complex was reported to involve in root development (Shaar-Moshe & Brady, 2023), suggesting that PeIDD6 and PeIDD7 might be in a common regulatory pathway with it. These results fully demonstrated the function diversity of PeIDDs and the complexity of the regulatory pathways.