An efficient transformation method for tannin-containing sorghum

Plant materials and embryo isolation

Hongyingzi was provided by the Guizhou Drought Grain Sorghum Research Institute and planted in the experimental field of the Anhui University of Science and Technology. Immature seeds were harvested 10–12 days after flowering and surface sterilized using 75% ethanol (v/v) shaking at 220 rpm for 5 min. Subsequently, these immature seeds were transferred to 4% (v/v) sodium hypochlorite supplemented with two drops of Tween 20 and shaken for 10 min. Finally, the immature seeds were washed 5–7 times with sterilized water. IEs were isolated from immature seeds and transferred to a callus induction medium with the scutellum facing up.

Media for tissue culture

All media were based on MS medium were contained 4.43 g/L M519 powder with vitamins (PhytoTechnology Laboratories, Lenexa, KS, USA) and 30 g/L sucrose, and they were autoclaved at 121 °C for 15 min. Indole-3-butyric acid (IBA), indole-3-acetic acid (IAA), copper sulphate (CuSO₄), 6-benzylaminopurine (6BA), and 1-naphthaleneacetic acid (NAA) were sterilized using 0.22 µm polyether sulfone (PES) syringe filters. These plant hormones were added after autoclaving at 70 °C. The compositions of different media were modified from previous work (Do et al., 2016; Liu & Godwin, 2012) and are listed in Table 1.

Optimization of rooting medium

All transgenic plants were separately transferred to root induction (RM) and new-root induction (NRM) and kept for 10 days in a tissue culture room, in which the temperature was maintained at 28 °C under a lighting regime of 16 h light (100–150 µmol m⁻² s⁻¹) and 8 h dark. The number of roots of the seedlings was recorded and analyzed.

Constructs

The two constructs (NPTII and DsRed) were provided by the Key Laboratory of Forage Breeding and Utilization of the Anhui Higher Education Institute (Fig. 1). NPT II (pMD18T-UBI-NPT II) and DsRed (pCambia-Ubi-DsRed) were driven by the maize ubiquitin1 (ubi1) promoter.

Kill curve experimentation

IEs were incubated on callus induction (CIM) for 9 days. A kill curve experiment was conducted using calli derived from the IEs. The calli were placed on selective regeneration medium containing G418 at 0, 10, 20, 30, 40, and 50 mg/L. Four weeks later, the number of shoots and surviving IEs was recorded and photographed.

Transformation by particle bombardment

Calli (10–12 per plate) were transferred to the osmotic medium (OM), stored for 2–3 h, and then bombarded. The transgenic protocol was performed as described previously by Wang et al. (2021), with 0.6 gold particles and 9 cm distance from the stopping screen to the calli.

Selection of transgenic plants

IEs were incubated on CIM for 7–10 days, followed by incubation on SEL-REG dishes for 4–6 weeks. IEs were transferred to fresh medium every 2 weeks. When the callus produced fibrous shoots with a length of 3–6 cm, it was transferred to a tube (150 mm in length, 30 mm in diameter) with a selection NRM medium. After 2 weeks, the transgenic plants were planted in pots with TS1 soil (KLASMANN, Geeste, Germany) and watered once per day. Before being transferred to the greenhouse, they were maintained in a culture room (24–25 °C) for 3 days.

Callus induction, osmosis, and resting were performed in the dark at 28 °C. Selective regeneration and rooting were performed in a tissue culture room at 28 °C under 16 h lighting (100–150 µmol m⁻² s⁻¹) and 8 h dark.

Molecular analysis of transformants

DNA (DeoxyriboNucleic Acid) was extracted from the leaves of putative transgenic and non-transgenic plants. To confirm the presence of nptII and DsRed, the fragments nptII and bar were amplified from genomic DNA using the following specific primer pairs: NPTIINN-f: TCCGGTGCCCTGAATGAA, NPTIINN-r: GTCGATGAATCCAGAAAAGC, and Bar-F: CTCGAGTCTACCA TGAGCCCAGAAC and Bar-R: CTCGAGTCAAATCTCGGTGACGGGCA. The amplified products were 400 and 466 bp, respectively. PCR (polymerase chain reaction) was performed in 30 µL reaction mixtures, which each contained 6 µL of template DNA (50 ng/µL), 4 µL Taq Buffer (20 mM Mg²⁺) 4 µL Taq dNTP (2.0 mM), 6 µL primer (20 mM), and 1.5 µL Taq DNA polymerase (Monad Biolabs). PCR was performed at 94 °C for 7 min, followed by 35 cycles consisting of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 50 s, and a final 7 min elongation step at 72 °C. PCR products were analyzed by electrophoresis using 1.0% agarose gels.

Reporter gene observation

The pCambia-Ubi-DsRed construct was transformed into calli. To detect fluorescence, the roots of putative transgenic and non-transgenic plants were observed and photographed under a Leica DM3000 microscope (Leica, Wetzlar, Germany). Subsequently, the cells of putative transgenic plants were separated from the roots and observed under a microscope.

Transgene inheritance assay

Seeds of the transgenic plants were harvested for the inheritance assay. Non-transgenic seeds were used as controls. They were placed in a petri dish and soaked in 50 mg/L G418. The dishes were then kept in a tissue culture room and cultured for 1 week under 16 h light and 8 h dark. Photographs were then taken of the transgenic and non-transgenic seeds.

Statistical analyses

Rooting efficiency date were analyzed using the t-test by the SPSS 26.0 statistical software (IBM Corp. Armonk, NY, USA). Triplicate measurements were averaged and included the standard error (±SE).

Morphological analyses of calli

Du et al. (2019) identified Type I, Tense Type II, and Loose Type II calli in maize. We discovered two types of calli after induction of IEs for 7 days. Type I calli showed severe browning with a smooth surface and a hard shell (Fig. 2A). Type II calli showed a bright colour, granular shape, and noticeable moisture content (Fig. 2B). Compared to Type I calli, Type II calli grew faster. After 9 days of culture, Type II calli formed a loose structure with a white dry surface (Fig. 2C), which was similar to that of the Loose Type II calli found in maize. In this study, we selected Type II calli for the subsequent research.

Optimization of rooting medium

To optimize the rooting medium, the rooting efficiency were compared in two different rooting media. In RM, plants did not generate roots and exhibited severe browning (Figs. 3A and 3C). However, the plants could grow roots normally and browning was apparently relieved in NRM (Figs. 3B and 3D). Finally, the average of rooting efficiency was 20.7% ± 2.8% and 64.7% ± 4.7% in RM and NRM, respectively. The results showed that rooting efficiency was significantly higher in NRM than in RM (P = 0.00335). Therefore, NRM was used for subsequent transformations.

Kill curve experiment using G418 on IEs

To optimize the kill concentration for transformation, the different concentrations of G418 were compared (Table 2). The results showed that no IEs or shoots survived at the G50. However, IEs and shoots on regeneration medium showed healthy growth with vigorous shoots at G0 (Table 2). Therefore, G50 was selected for the subsequent transformation experiments.

Selection of putative transgenic plants

IEs formed small white calli after they were cultured on CIM for 5 days (Fig. 4A). Type II calli were selected for transformation. Necrotic calli and tender leaves appeared in the first 2 weeks on SEL-REG medium (Fig. 4B). In the next 2 weeks, part of the callus formed fibrous shoots (Fig. 4C). Subsequently, these plants were transferred to the NRM for 2 weeks. Plantlets showing strong growth were transplanted into pots for 1 week (Fig. 4D). Then they were planted in a greenhouse. The survival rate was 90%. Approximately 8–11 weeks is required from IEs isolation to planting. The transformation efficiency varied from 25.7% to 28.2%, with an average efficiency of 27% (Table 3).

PCR analysis of transgenic events

Putative transgenic plants were detected using PCR. The results showed that all transgenic plants amplified the same 466 bp fragment as in the construct. Water and non-transgenic plants were used as controls with no PCR products (Fig. 5A). All eight plants were transgenic. Furthermore, the bar gene was used for PCR amplification. PCR analysis revealed that seven of the eight samples showed the bar gene specific fragment (Fig. 5B). In general, the co-transformation rate was 87.5%.

Red fluorescent protein expression

To verify whether the DsRed gene was properly expressed in transgenic plants, the roots from transgenic and non-transgenic plants were observed. The root from transgenic plants showed a bright red colour, whereas the roots from non-transgenic plants did not (Figs. 6A and 6B). The bright red colour also can be observed from root cells in transgenic plants (Fig. 6C). The results confirmed that the DsRed gene was expressed normally in transformed sorghum.

Transgene inheritance assay

To determine whether the transgene nptII was inherited and expressed in the next generation, an inheritance assay was performed for non-transgenic and transgenic seeds. The results showed that non-transgenic seeds did not grow roots in the G418 solution (Fig. 7A). However, putatively transformed plants grew normally in G418 solution (Fig. 7B). PCR also was performed to analyze the T₁ generation of transgenic plants. The results showed that all transgenic plants amplified the same fragment as the bar plasmid at 466 bp. The water and non-transgenic plants were not able to amplify any fragments (Fig. 8). These results showed that the transgene was stably inherited into the next generation.