Photosynthetic performance and stevioside concentration are improved by the arbuscular mycorrhizal symbiosis in Stevia rebaudiana under different phosphate concentrations

Inoculation with Rhizophagus irregularis and plant growth conditions

R. irregularis was provided by Dr. Melina López-Meyer from “Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional, Unidad Sinaloa”, Sinaloa state, Mexico. The inoculum was grown on Petri dishes with two compartments containing transformed carrot roots on minimum medium with 2% Gel-rite (Sigma-Aldrich) and incubated in the dark at 23 ± 2 °C for six months according to the method reported by Bécard & Fortin (1988).

Six-month-old cuttings of S. rebaudiana plants were cultured under greenhouse conditions. Briefly, seven-cm cuttings were disinfected with 70% ethanol for 1 min and 2% sodium hypochlorite for 1 min and washed three times with sterile distilled water for 2 min. To measure root development, the cuttings were transplanted under hydroponic conditions in glass tubes containing Fahraeus medium and cultured in a controlled environment chamber at 25 °C with a 16 h light: 8 h dark photoperiod regimen. After ten days of culture, the rooted cuttings were transferred to plastic cones of 125 mm high and 32 mm diameter (M49, Polietilenos del Sur S.A. C.V.), one plant per cone. The substrate used was a 1:1 (v:v) mixture of vermiculite and sand. The substrate was autoclaved twice for 1 h at 121 °C and 15 psi. S. rebaudiana plants were inoculated with 150 spores of R. irregularis (M+) that were homogeneously distributed in the substrate; the controls were noncolonized (M-) plants. The plants were watered twice per week with 20 mL of half-strength Hoagland nutrient solution (Hoagland & Arnon, 1950) with KH₂PO₄ at the final phosphate concentrations that were evaluated: 20, 200, 500, and 1,000 µM. The pH of the nutrient solutions was adjusted to 6.1.

The plants were maintained in a growth chamber at 25 °C with a 16 h light:8 h dark photoperiod regimen for 30 days postinoculation (dpi). The experiment was performed utilizing a complete factorial design, and six plants per phosphate concentration and colonization status with R. irregularis were evaluated. The controls were noncolonized plants treated with the different phosphate concentrations. Two independent experiments were performed. Similar trends were obtained in the both experiments, and the results of only one of them are shown.

Staining and quantification of mycorrhizal colonization

S. rebaudiana root segments were stained with 0.05% trypan blue in lactoglycerol (Phillips & Hayman, 1970) and observed by light microscopy (BOECO Germany, BM-180) at 10-40X magnification. Total mycorrhizal colonization by R. irregularis was calculated according to the line-intersection method (Giovannetti & Mosse, 1980). For each plant, 90 root segments were assessed, and six plants were evaluated. The arbuscular percentage was calculated with MycoCalc software (https://www2.dijon.inrae.fr/mychintec/Mycocalc-prg/download.html). To identify the morphological type of the AM symbiosis in S. rebaudiana, mycorrhizal roots were stained with WGA-Alexa Fluor 488 to visualize the arbuscules, and the plant tissue was labeled with propidium iodide according to the methodology reported by Xie et al. (2016) using confocal laser scanning microscopy (LSM 800, Carl Zeiss).

Determination of plant growth

The plants treated with the different phosphate concentrations and colonized (M+) or noncolonized (M-) with R. irregularis were collected at 30 days postinoculation (dpi). Shoots and roots of each plant were separated, total leaves number and the fresh weight of each organ was recorded. To minimize the dependency of the analysis of expression of genes and SG quantification with the leaf position on the plant. The leaves were collected in two equivalent groups, considering their opposite arrangement of the leaves and their position along the stem. Then, leaves positioned on each side of all the nodes of the plant composed each group.

The leaf area was determined by image analysis from leaves of the second node, close to the apical meristem. A stereomicroscope (Olympus SZX7, Germany) was used to obtain the micrographs. Image analysis was performed using ImageJ editing software (Version, 1.8.0.112).

One half of the leaves were frozen in liquid nitrogen for molecular analysis, and the other half for SG extraction.

Root were also collected and separated longitudinally in two sections, one of them was used for determination of mycorrhizal colonization, and the other for mycorrhiza-specific phosphate transporter identification. Six plants per phosphate treatment and R. irregularis colonization status were evaluated.

Analysis of phosphorus and magnesium concentration

The leaves of S. rebaudiana plants were prepared according to Guerrero-Molina et al. (2014). The leaves were analyzed by a high-resolution scanning electron microscope (SEM) equipped with a field emission cathode and coupled to an energy-dispersive X-ray (EDX, Carl Zeiss, Oberkochen, Germany). The electron energy used was 20 keV. The mapping of P and Mg was determined by EDX to record the two-dimensional elemental composition of the leaf sample surface. For quantitative analyses, EDX spectrograms were recorded and analyzed using QUANTAX ESPRIT, Version 1.9 (BRUKER, Germany). Since the results of the concentration of each element is given as the percentage of such element with respect to all the components determined in the sample, the concentration of P and Mg in the samples was expressed as the percentage of each element in the leaves.

Determination of chlorophyll and carotenoid concentration

The determination of chlorophyll and carotenoids concentration was made from three fresh leaves (approximately 100–150 mg) of each of the six plants of the M- and M + conditions. The leaves were collected from the upper, middle and lower part of each one of the analyzed plants and were ground in a mortar with 80% acetone. The extracts were centrifuged at 3,000 g for 15 min; the supernatants were separated, and the absorbance at 646.8, 663.2 and 470 nm was measured in a UV/Vis spectrophotometer (UV-1800, Shimadzu, Japan). The concentration of chlorophylls and carotenoids were calculated following the equations described by Khan & Mitchell (1987).

Measurement of chlorophyll fluorescence

The chlorophyll fluorescence was measured in the second fully expanded leaf of each plant using a chlorophyll fluorometer (model OS30P, Opti-Sciences Inc., USA). The evaluation was performed at room temperature according to the instructions for the chlorophyll fluorometer. Before the evaluation, the plants were placed in the dark for 30 min, and chlorophyll fluorescence was evaluated after applying a 1 s saturating pulse of actinic light (3,500 µmol m⁻² s⁻¹). The primary fluorescence (Fo), maximal fluorescence (Fm), maximum quantum efficiency of PSII photochemistry (Fv/Fm), and potential photochemical efficiency (Fv/Fo) were calculated. Fv was calculated as Fv = Fm −Fo, and Fv/Fo was calculated as Fv/Fo = Fm/Fo −1 (Schreiber, Bilger & Neubauer, 1994).

Expression analysis by qRT-PCR

The transcript accumulation levels of the genes for kaurene oxidase and (UDP)-glycosyltransferases were evaluated in colonized and noncolonized plants and in plants that were treated with 200 and 1,000 µM KH₂PO₄. These phosphate concentrations were selected because they were found to be the optimal and suboptimal conditions for inducing root colonization. Frozen leaves, from one of the groups described in the determination of plant growth section, were ground to a fine powder in liquid nitrogen. Total RNA was isolated from leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. First-strand cDNA synthesis was performed as previously reported by Cervantes-Gámez et al. (2016).

The primers used were those designed and reported by Mandal et al. (2015) for S. rebaudiana plants. The primers correspond to the kaurene oxidase gene (SrKOF 5′- TCTTCACAGTCTCGGTGGTG-3′, and SrKOR 5′-GGTGGTGTCGGTTTATCCTG-3′), the glucosyl transferase UGT74G1 gene (SrUGT74G1F 5′- GGTAGCCTGGTGAAACATGG-3′, and SrUGT74G1R 5′- CTGGGAGCTTTCCCTCTTCT - 3′) and the glucosyl transferase UGT76G1 gene (SrUGT76G1F 5′- GACGCGAACTGGAACTGTTG-3′, and SrUGT76G1R 5′- AGCCGTCGGAGGTTAAGACT - 3′). qRT-PCR was performed using SYBR^® Green (QIAGEN, USA) and quantified on a Rotor-Gene Q (QIAGEN, USA) real-time PCR thermal cycler. qRT-PCR was programmed for 35 cycles, with denaturing at 95 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. Primer specificity was verified by regular PCR and melting curve analysis. The primers for the S. rebaudiana glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (SrGAPDHF 5′- TCAGGGTGGTGCCAAGAAGG-3′, and SrGAPDHR 5′- TTACCTTGGCAAGGGGAGCA - 3′) were used as internal controls for normalization, and the quantitative results were evaluated by the 2^−ΔΔCT method described by Livak & Schmittgen (2001). To interpret the results, genes with fold change values ≥1.5 were considered “upregulated”, whereas genes with fold change values ≤ −0.7 were considered “downregulated”. Six plants per phosphate treatment and R. irregularis colonization status were evaluated.

Cloning the mycorrhiza-specific phosphate transporter gene from S. rebaudiana

A pair of degenerate primers (SrPTF 5′- ATGGGDTTTTTYACYGATGC-3′and SrPTR 5′- GGNCCAAARTTSGCRAAGAA- 3′) were designed by aligning highly conserved regions of AM-specific phosphate transporters from M. truncatula (accession number: AY116210), A. sinicus (accession number: JQ956418), S. lycopersicum (accession number: AF022874), S. tuberosum (accession number: AY793559) and P. hybrida (accession number: EU532763). The PCR product was purified using the QIAquick PCR Purification Kit (QIAGEN, USA) and ligated into the pGEM^®-T Easy vector (Promega, USA) in accordance with the manufacturer’s protocols. The presence of the correct insert (1350 bp) within the pGEM^®-T Easy vector was confirmed by PCR using the universal primers T7 and SP6, and the insert was then sequenced.

Collected roots from one of the groups described in the determination of plant growth section, were ground to a fine powder in liquid nitrogen. Total RNA was obtained from the roots of six colonized (M+) and six noncolonized (M-) plants fertilized with 200 µM KH₂PO₄. RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. First-strand cDNA synthesis was performed as previously reported by Cervantes-Gámez et al. (2016). cDNA synthesis was confirmed by PCR using primers for the S. rebaudiana glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (SrGAPDHF 5′- ATGGGDTTTTTYACYGATGC-3′and SrGAPDHR 5′- GGNCCAAARTTSGCRAAGAA- 3′).

For the expression analysis of SrPT in the M- and M+ plants, PCRs were run in a total reaction volume of 10 µL, comprising 0.2 µL of GoTaq^® Flexi DNA Polymerase (Promega, USA), 200 nM of each primer, and 50 ng of cDNA. The PCR thermocycler was programmed for 35 cycles, with denaturing at 95 °C for 15 s, annealing at 52 °C for 1 min, and extension at 72 ° C for 30 s. The SrGAPDH gene was used as the reference gene.

Homology modeling analysis of the AM-specific phosphate transporter from S. rebaudiana

BLAST analysis of the SrPT gene sequence was performed to determine homology predictions using the tools on the NCBI website (https://www.ncbi.nlm.nih.gov). To determine the conserved region of SrPT, multiple sequence alignments of AM-specific phosphate transporter proteins were performed using MULTALIN software. The homology model of SrPT transmembrane domains (TDs) was constructed according to Yadav et al. (2010), and the Mtpt4 protein structure from M. truncatula was used as the template for homology modeling for the S. rebaudiana AM-specific phosphate transporters.

Steviol glycosides extraction and quantification of concentration

The leaves of colonized (M+) and noncolonized (M-) plants that were treated with 200 and 1,000 µM KH₂PO₄ were used to evaluate the SG concentration. Leaves from one of the groups described in the determination of plant growth section, were dried in in an oven (Thermo Scientific, USA) at 65 °C for 48 h. The dry leaf tissue (0.1 g) was extracted with one mL of methanol (J.T. Backer, USA), following the methodology described by Woelwer-Rieck et al. (2010). The mixture was stirred for 3 min, allowed to stand for 24 h without stirring, and then centrifuged at 10,000 rpm at 4 °C for 10 min. The supernatant was recovered, placed in Eppendorf tubes, and stored at −4 °C until the analysis by HPTLC (CAMAG, Switzerland). The quantification of SGs was based on the methodology reported by Bladt & Zgainski (1996) and Morlock et al. (2014), and described recently by Villamarin-Gallegos et al. (2020). Stevioside and rebaudioside A concentration were expressed in mg g DW⁻¹. Six plants per phosphate treatment and R. irregularis colonization status were evaluated.

Statistical analysis

The differences between the total colonization and arbuscular percentages were examined by one-way analysis of variance (ANOVA), and Tukey’s post hoc test (P < 0.05) was performed to test the significance of differences between means. Data regarding the effect of the interaction between the KH₂PO₄ concentration and mycorrhizal colonization on plant growth, P and Mg concentration, pigment concentrations, chlorophyll fluorescence and SG concentration were subjected to factorial two-way analysis of variance (ANOVA). Tukey’s post hoc test was used to analyze the differences. The paired Student’s t-test was used to evaluate the significance of differences in the gene expression of kaurene oxidase and (UDP)-glycosyltransferases. All data used for ANOVA and factorial analysis were checked for normal distributions (Shapiro–Wilk’s test) before statistical analysis. All statistical analyses were performed using the statistical software IBM SPSS for Windows, Version 24.0 (Armonk, NY, IBM Corp.).

Phosphate concentration affects the mycorrhizal colonization of S. rebaudiana

The highest percentages of colonization were obtained at 20 and 200 µM KH₂PO₄ (73.3 and 67.0% colonization, respectively). In contrast, the percentage of total colonization decreased significantly at 500 and 1,000 µM KH₂PO₄, with 43.3 and 18.4% colonization, respectively (Fig. 1). The percentage of arbuscules was significantly reduced at 500 and 1,000 µM KH₂PO₄, with 1.48 and 0.4%, respectively (Fig. 1).

In the roots of plants treated with 20 µM KH₂PO₄, a high number of arbuscules formed (Fig. 2A, see label *); several intraradical hyphae grew through the cortical cells (Fig. 2A, see label ih), although vesicle structures were scarce. Similar structures were observed in colonized plants (M+) with 200 µM KH₂PO₄; however, under these experimental conditions, the formation of arbuscules and vesicle structures was more evident (Fig. 2B, see labels * and v), indicating that 200 µM KH₂PO₄ created better conditions than 20 µM for the formation of arbuscules. Qualitative differences in mycorrhizal structures were observed when plants were treated with the highest KH₂PO₄ concentrations (500 and 1,000 µM); the formation of arbuscules, for instance, was significantly reduced (Figs. 2C and 2D, see label *), and shortening of intraradical structures was observed (Figs. 2C and 2D, see label ih) in comparison to the structures observed at low KH₂PO₄ concentrations (Figs. 2A and 2B).

The activation of specific genes, such as the phosphate transporter specifically induced by the mycorrhizal association, is an important marker for evaluation successful colonization establishment. To our knowledge, there is no information on this transporter type in S. rebaudiana. For this reason, we identified a putative mycorrhiza-specific phosphate transporter in S. rebaudiana (SrPT) by a simple PCR strategy based on degenerate oligonucleotides to clone the corresponding phosphate transporter. A 1175 bp-long genomic fragment containing an open reading frame that encodes a 391-amino acid polypeptide with a molecular mass of 43.39 kDa was cloned (accession number: MN273502). This putative SrPT polypeptide contains 9 of the 12 transmembrane domains from the canonic phosphate transporter (Fig. S1). The bioinformatic analysis suggests that SrPT is 72.89% conserved in comparison to the sequences reported for MtPT4 TMDs in Medicago truncatula. Notably, SrPT transcript accumulation increased in the roots of colonized (M+) plants compared with that in the roots of noncolonized (M-) plants. This result suggests that this gene is positively regulated by AM symbiosis in S. rebaudiana, in a similar manner to the genes for other mycorrhiza-specific phosphate transporters reported in other model plants (Fig. S2).

Confocal microscopic analysis of the colonized roots and staining with the conjugate WGA-Alexa Fluor^® 488 and propidium iodide as fluorescent markers permitted us to differentiate the hyphae and the plant cells, respectively. Intracellular hyphae and the formation of arbuscules from intracellular hyphae growing in the inner cortex were observed (Figs. 2E–2G, see labels ih and *). With this approach, we were able to depict and classify this structure as a typical Arum-type mycorrhiza.

Mycorrhizal colonization improves plant growth in S. rebaudiana

In the M- plants, the leaf fresh weight was not different than that in plants treated with 20, 200 and 500 µM KH₂PO₄; the leaf fresh weight only increased significantly at 1,000 µM KH₂PO₄ (Fig. 3A). In the M+ plants, the leaf fresh weight increased by a factor of 1.74 with 200 µM KH₂PO₄ in comparison to that in the M- plants (control) at the same phosphate concentration. However, no difference was found between M+ and M- plants at 1,000 µM KH₂PO₄. The leaves of M+ plants with 200 µM KH₂PO₄ had a similar fresh weight to those of M+ and M- plants treated with 1,000 µM KH₂PO₄ (Fig. 3A). In plants treated with 200 µM KH₂PO₄, the fresh weight of roots was higher in the roots of M+ plants than in the roots of M-plants. At 1,000 µM KH₂PO₄, the fresh weight of roots was higher in the M+ plants than in the M- plants (Fig. 3B). Leaf number and foliar area were determined, and only at 200 µM KH₂PO₄, M- plant showed fewer leaves than M+, as well as foliar area (Fig. S3), which is consistent with the pattern of fresh weight of leaves. Foliar area, on the other hand, was only significantly lower in M+ plants than M- plants at 500 µM KH₂PO₄ (Fig. S3).

The phosphorus and magnesium concentration increases in the leaves of colonized plants with a low phosphate concentration

The P concentration was four times higher in the leaves of M+ plants treated with 200 µM KH₂PO₄ than that in M- plants. At 500 and 1,000 µM KH₂PO₄, the P concentration was similar in the leaves of M+ plants and M- plants (Fig. 4A). In the leaves of M- plants, the Mg concentration increased significantly at 500 and 1,000 µM KH₂PO₄, while in the leaves of M+ plants, the Mg concentration increased at 20, 200 and 1,000 µM KH₂PO₄, but the Mg concentration was lower at 500 µM KH₂PO₄ (Fig. 4B). These results suggest that AM symbiosis can stimulate P and Mg accumulation at low KH₂PO₄ concentrations.

Chlorophyll fluorescence and the concentration of photosynthetic pigments improve in colonized plants at a low phosphate concentration

Chlorophyll fluorescence was used as an indicator of photosynthetic performance in the S. rebaudiana plants. In M- plants and at all KH₂PO₄ concentrations, the Fv/Fm ratio values were less than 0.8. In M+ plants at 20 and 200 µM KH₂PO₄, the Fv/Fm ratio values were greater than 0.8, and at 500 and 1,000 µM KH₂PO₄, the Fv/Fm ratio values diminished to less than 0.8 (Fig. 5A). The Fv/Fo ratio is indicative of the photochemical efficiency of photosynthesis. In the M- plants at all phosphate concentrations, the values of the Fv/Fo ratio were less than 4.0. In M+ plants at 20 and 200 µM KH₂PO₄, the value of the Fv/Fo ratio was greater than 4.0; at 500 and 1,000 µM KH₂PO₄, this ratio was less than 4.0 (Fig. 5B). The values of Fo, Fm and Fv are presented in Fig. S4.

The total concentration of chlorophylls and carotenoids did not change in the M- plants at any phosphate concentration. However, in M+ plants at 20 and 200 µM KH₂PO₄, the concentration of chlorophylls and carotenoids was higher as compared to the M- plants at the same phosphate concentrations; at 500 and 1,000 µM KH₂PO₄, the concentration of the two pigments were similar in M- and M+ plants (Figs. 5C and 5D).

Differential expression of the genes for kaurene oxidase and glucosyltransferases in colonized plants with added phosphate

The transcription of the kaurene oxidase (KO) gene was increased 7.5 times in M+ plants at 200 µM KH₂PO₄ compared with that in M+ plants without added KH₂PO₄. The transcription level of the KO gene did not change in M+ plants at 1,000 µM KH₂PO₄ in comparison to M- plants, since the relative expression (2 ^−ΔΔCt) was close to 1 (Fig. 6A). The UGT74G1 gene encoding the protein involved in stevioside synthesis was upregulated in M+ plants at 200 µM KH₂PO₄; the level of relative expression was over 1.5 (Fig. 6B). The UGT76G1 gene encoding the protein involved in rebaudioside A synthesis was downregulated in M+ plants at the same KH₂PO₄ concentration, and its relative expression was less than 0.7 (Fig. 6C). However, in M+ plants at 1,000 µM KH₂PO₄, the expression of the UGT74G1 gene was downregulated, and the expression of the UGT76G1 gene was unchanged (Figs. 6B and 6C).

SGs differentially accumulate in the leaves of colonized plants with added phosphate

In M+ plants at 200 µM KH₂PO₄, the stevioside concentration was 2.8 times higher and the rebaudioside A concentration was 1.61 times lower than those of M- plants (Figs. 7A and 7B). This metabolite accumulation is consistent with the transcript levels of the corresponding glucosyl transferases (Figs. 6B and 6C). At 1,000 µM KH₂PO₄, the accumulation of the two metabolites in M+ and M- plants was not affected (Figs. 7A and 7B).