Differential expression of AtWAKL10 in response to nitric oxide suggests a putative role in biotic and abiotic stress responses

Phearom Bot; Bong-Gyu Mun; Qari Muhammad Imran; Adil Hussain; Sang-Uk Lee; Gary Loake; Byung-Wook Yun

doi:10.7717/peerj.7383

Differential expression of AtWAKL10 in response to nitric oxide suggests a putative role in biotic and abiotic stress responses

Phearom Bot¹, Bong-Gyu Mun¹, Qari Muhammad Imran¹, Adil Hussain², Sang-Uk Lee¹, Gary Loake ³, Byung-Wook Yun ¹

1Department of Applied Biosciences, Kyungpook National University, Daegu, South Korea

2Department of Agriculture, Abdul Wali Khan University Mardan, Mardan, Pakistan

3Institute of Molecular Plant Sciences, University of Edinburgh, Edinburgh, UK

DOI: 10.7717/peerj.7383

Published: 2019-08-16
Accepted: 2019-06-30
Received: 2018-12-20

Academic Editor: Yuriy Orlov

Subject Areas: Genomics, Molecular Biology, Plant Science
Keywords: AtWAKL10, Salt stress, Drought, Promoter analysis, Effector-triggered immunity, Basal defense

Copyright: © 2019 Bot et al.
Licence: This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited.

Cite this article: Bot P, Mun B, Imran QM, Hussain A, Lee S, Loake G, Yun B. 2019. Differential expression of AtWAKL10 in response to nitric oxide suggests a putative role in biotic and abiotic stress responses. PeerJ 7:e7383 https://doi.org/10.7717/peerj.7383

The authors have chosen to make the review history of this article public.

Abstract

Plant defense against pathogens and abiotic stresses is regulated differentially by communicating signal transduction pathways in which nitric oxide (NO) plays a key role. Here, we show the biological role of Arabidopsis thaliana wall-associated kinase (AtWAK) Like10 (AtWAKL10) that exhibits greater than a 100-fold change in transcript accumulation in response to the NO donor S-nitroso-L-cysteine (CysNO), identified from high throughput RNA-seq based transcriptome analysis. Loss of AtWAKL10 function showed a similar phenotype to wild type (WT) with, however, less branching. The growth of atwakl10 on media supplemented with oxidative or nitrosative stress resulted in differential results with improved growth following treatment with CysNO but reduced growth in response to S-nitrosoglutatione (GSNO) and methyl-viologen. Further, atwakl10 plants exhibited increased susceptibility to virulent Pseudomonas syringae pv tomato (Pst) DC3000 with a significant increase in pathogen growth and decrease in PR1 transcript accumulation compared to WT overtime. Similar results were found in response to Pst DC3000 avrB, resulting in increased cell death as shown by increased electrolyte leakage in atwakl10. Furthermore, atwakl10 also showed increased reactive oxygen species accumulation following Pst DC3000 avrB inoculation. Promoter analysis of AtWAKL10 showed transcription factor (TF) binding sites for biotic and abiotic stress-related TFs. Further investigation into the role of AtWAKL10 in abiotic stresses showed that following two weeks water-withholding drought condition most of the atwakl10 plants got wilted; however, the majority (60%) of these plants recovered following re-watering. In contrast, in response to salinity stress, atwakl10 showed reduced germination under 150 mM salt stress compared to WT, suggesting that NO-induced AtWAKL10 differentially regulates different abiotic stresses. Taken together, this study further elucidates the importance of NO-induced changes in gene expression and their role in plant biotic and abiotic stress tolerance.

Introduction

Nitric oxide (NO), diatomic molecule is a gaseous free radical known for its signaling role under stress condition (Delledonne et al., 1998). This small redox active molecule got fair attention of scientists in the recent past not only due to its signaling but also its regulatory role. Initially identified in mammals with medical roles in cardiac diseases (Hiraga et al., 1998; Liu et al., 2004; Fraccarollo et al., 2009; Liu et al., 2004); NO was reported to have equally important roles in plants (Delledonne et al., 1998; Durner, Wendehenne & Klessig, 1998; Delledonne, 2005). In the last couple of decades, NO has been reported to regulate a number of physiological processes such as germination (Beligni & Lamattina, 2000) Chlorophyll contents (Leshem et al., 1997), adventitious roots development (Pagnussat et al., 2002), root elongation (Gouvêa et al., 1997), flowering time (He et al., 2004) apical dominance (Lee et al., 2008) hormonal balance (Yu et al., 2014) and plant defense (Delledonne et al., 1998; Feechan et al., 2005; Yun et al., 2011) etc.

Nitric oxide in the presence of oxygen form different important oxides like NO₂ that may further react with cellular amines and thiols. It can also react with superoxide anion radical (O2^̇-) producing such ions that later on cause significant damage to cell structure (Wendehenne et al., 2001). These molecules are also called reactive nitrogen species (RNS). The production of reactive oxygen and nitrogen species (ROS and RNS) is an important outcome in response to biotic and abiotic stresses (Garcia-Mata & Lamattina, 2002; Burniston & Wilson, 2008). Controlled ROS production is extremely important for activating downstream processes. For example, hydrogen peroxide (H₂O₂) leads to modulation of the cellular redox state and may regulate certain defense-related processes including programed cell death (PCD) and biotic (Harding et al., 2003; Suzuki et al., 2011) and abiotic stress responses (Madhava Rao & Sresty, 2000). However, contrary to well-studied ROS, little is known about the RNS and their roles in plants.

Plants have evolved fine-tuned mechanisms to cope with attempted pathogen ingress. One of these defense responses includes the evolution of resistance (R) genes to defend themselves against pathogen attacks. R-genes encode proteins that either recognize pathogen avirulence (Avr) proteins or their activities (Dangl & Jones, 2001; Jones & Dangl, 2006). Pathogen recognition prevents pathogen expansion via a variety of mechanisms, including localized PCD which may involve signaling components analogous to animal apoptosis (Plocik, Layden & Kesseli, 2004).

The intracellular secondary messenger guanosine 3′, 5′-cyclic monophosphate (cGMP) has been reported to be an important signaling molecule controlling a wide range of physio-molecular responses in both prokaryotes and eukaryotes (Schaap, 2005). In higher plants cGMP is reported to be involved in signaling during various physiological processes (Newton & Smith, 2004). These include biotic (Durner, Wendehenne & Klessig, 1998), abiotic (Pasqualini et al., 2009) and NO-dependent signaling (Prado, Porterfield & Feijo, 2004). After the perception of stress responses, the guanylyl cyclase (GC) activates to catalyze the synthesis of cGMP from guanosine 5-triphosphate (GTP) (Schaap, 2005). However, despite the well-explored role of cGMP in signaling, the role of its catalytic enzyme GCs in higher plants is yet to be identified. BLAST searches have identified about seven candidates GCs in Arabidopsis (Meier et al., 2010). One of these candidates is the Arabidopsis wall-associated kinase-like 10 ((AtWAKL10) AT1G79680). The WAK/WAKL genes are typically supposed to encode a class of receptor-like protein kinases having a transmembrane domain and a serine/threonine kinase domain in addition to an extracellular region that is closely associated with the cell wall (He et al., 1999). Reports suggested that some WAKs may be involved in pathogen defense responses. For example, AtWAK1 expression was induced after Pseudomonas syringae infection in Arabidopsis in NON-EXPRESSOR OF PR1 GENE (NPR1) dependent manner. Furthermore, AtWAK1 is also reported to be involved in systemic acquired resistance (SAR) (Maleck et al., 2000).

Nitric oxide transfers its bioactivity predominantly through a key post-translational modification termed S-nitrosylation: a cysteine-based protein modification in which a NO moiety is covalently attached to a solvent-exposed cysteine residue to form an S-nitrosothiol (Stamler et al., 1992; Khani et al., 2017). These SNOs then interact with intracellular sulfhydryl-containing molecules and are of great importance as they are more stable than NO (Leterrier et al., 2011). Among various SNOs, S-nitrosoglutathione (GSNO) is produced by the S-nitrosylation reaction of both NO with glutathione (GSH) and bears special importance since it is reported to be a mobile reservoir of NO (Stamler, Lamas & Fang, 2001). Cellular GSNO homeostasis is controlled by the enzyme GSNO reductase (GSNOR) (Liu et al., 2001) which is functionally conserved across the animal, plant and bacterial species. Research studies involving GSNOR support its ameliorating role during GSNO-mediated nitrosative stress (Foster et al., 2009; Stamler, Lamas & Fang, 2001). These properties make GSNOR vital enzyme for plant growth as cellular redox status is crucial to plant growth, development and environmental interactions (Malik et al., 2011). The loss-of-function mutation in GSNOR termed as atgsnor1-3 resulted in a significant reduction in plant growth and compromised defense response in Arabidopsis thaliana (Feechan et al., 2005; Yun et al., 2011).

Microarray and RNA-seq analysis have revealed a number of key genes showing differential expression to NO or its donors (Parani et al., 2004; Begara-Morales et al., 2014). Recently, Hussain et al. (2016) demonstrated several hundred genes showing differential response to the NO donor S-nitroso-L-cysteine (CysNO). Similarly, 673 transcription factors (TFs) including major TF families showed differential expression to the same NO donor (Imran et al., 2018a). Here we show AtWAKL10 a candidate gene of NO signaling that exhibited more than a 100-fold induction (Fold change 124.7) in response to CysNO and exhibits a role in both plant defense and oxidative stress for this gene product. AtWAKL10 is a positive regulator of basal defense, effector-triggered immunity and salt stress while negatively regulating drought stress.

Materials and Methods

Plant material, growth conditions and genotyping

Col-0 was used as wild type (WT), whereas atgsnor1-3, a loss-of-function mutant of Arabidopsis S-nitrosoglutathione reductase1 (AtGSNOR1) was used as a susceptible control (Feechan et al., 2005). Loss-of-function mutant lines for WAKL10 (AT1G79680) was procured from the Arabidopsis Biological Resource Center (ABRC, https://abrc.osu.edu/). Seeds were surface-sterilized using 50% bleach (commercial bleach) for about 1~2 minutes and grown on half-strength Murashige and Skoog (MS) media (Murashige & Skoog, 1962). After a week, seedlings were transplanted in soil and grown under controlled light (16–8 h.) and temperature (23 °C ± 2). atwakl10 plants were genotyped to identify homozygous lines using gene-specific forward and reverse and T-DNA border primers using PCR. The list of primers is given in Table 1. The PCR conditions were initial denaturation at 94 °C for 2 min followed by 30 cycles of 94 °C for 20 s, 58 °C for 30 s and 72 °C for 1 min and a final extension at 72 °C for 5 min. The identified homozygous lines were then used for further experiments.

Table 1:

List of primers used.

Gene name	Acc No	Forward (5′-3′)	Reverse (5′-3′)
Actin	AT3G18780	GCTGGACGTGACCTTACTGA	CCATCTCCTGCTCGTAGTCA
PR1	AT2G14610	GTGCAATGGAGTTTGTGGTC	TCACATAATTCCCACGAGGA
AtWAKL10	AT1G79680	CACTAGCGCATGAACATGTTG	AAACCCGTCTCTGCTTTTAGC
Sail border primer	SAIL_LB1	GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC

DOI: 10.7717/peerj.7383/table-1

Oxidative and nitrosative stress assay

To study the response of atwakl10 towards oxidative and nitrosative stresses plants were subjected to oxidative and nitrosative stress as described earlier (Imran et al., 2016). Briefly, for nitrosative stress conditions, sterilized Arabidopsis seeds from WT Col-0, atgsnor1-3 and atwakl10 were sown on media supplemented with one mM CysNO or one mM GSNO. For exposure to oxidative stress, sterilized seeds from Col-0 and mutant line were grown on media supplemented with two mM H₂O₂ or one µM Methyl Viologen. For all treatments, plants were grown in 16 and 8 h light and dark conditions, respectively in triplicates at 23 °C ± 2 temperature. The experiments were repeated twice and cotyledon development frequency (CDF) was recorded after 1 week as described by Imran et al. (2016). The term CDF was used for green developed cotyledons.

Pathogen inoculations and cell death

Pseudomonas syringae pv. tomato (Pst) strain DC3000 was cultured and maintained as described (Whalen et al., 1991). Briefly, virulent Pst DC30000 (concentration 0.0002 at OD₆₀₀ i.e. 5 × 10⁵ CFU mL⁻¹) and avirulent Pst DC30000 avrB (concentration 0.002 at OD₆₀₀ i.e. 1 × 10⁶ CFU mL⁻¹) were grown on LB (Luria-Bertani) media with appropriate antibiotics (Rifampicin, Kanamycin and Rifampicin, respectively). The single colony was then transferred to LB broth and incubated at 28 °C overnight with shaking. Both the bacterial strains were then harvested by centrifugation in 10 mM MgCl₂. The inoculum thus prepared was infiltrated into the abaxial side of leaves at the indicated concentration. After 2 and 4 days of inoculation, disease symptoms were recorded and leaf samples (four replicates) were harvested for bacterial growth analysis (Feechan et al., 2005).

Histological staining

The avirulent strain of Pst DC3000 expressing the avrB effector protein interacts with plant R-genes thereby triggering hypersensitive cell death response (HR) (Leister, Ausubel & Katagiri, 1996). To see pathogen-induced cell death in vivo, all the genotypes were infiltrated with Pst DC3000 avrB and cell death in inoculated leaves was measured by trypan blue staining (Yun et al., 2011). To visualize H₂O₂ in situ we used the already established method (Yun et al., 2003). Briefly, leaves inoculated with Pst DC3000 avrB were stained with 3-3′-diaminobenzidine (DAB) which is absorbed by the plant and polymerized locally in the presence of H₂O₂ and peroxidases giving a visible brown stain. The inoculated leaves were dipped in DAB solution and put on a shaker overnight. The DAB solution was then replaced with 96% ethanol and boiled for 10 min. The leaves were then allowed to cool-down and washed with ddH₂O two times. The leaves were then mounted on microscopic slides.

Electrolyte leakage

Pathogen-induced cell death was quantified by measuring electrolyte leakage. Briefly, one cm² leaf discs form the leaves inoculated with avirulent Pst DC3000 at a concentration of 1 × 10⁸ CFU mL⁻¹ were collected in triplicates with three leaf discs per replicate. The leaf discs were washed with deionized water and put in a multi-well plate (SPL life sciences, Pocheon-si, Korea) containing an equal amount of deionized water. Electrolyte leakage in each well was measured over time by conductivity meter (Horiba Twin Cond, Conductivity meter B-173).

Salt and drought stress

To test atwakl10 response to salt stress, seeds were placed on ½ MS media in petri dishes supplemented with 100 and 150 mM salt (NaCl). The control plants were grown on ½ MS media only. The petri plates were placed in the growth chamber at 23 °C ± 2 temperature for 16 and 8 h of light and dark period respectively. One week later, CDF was measured and pictures were taken. The drought stress was induced by withholding water for two weeks. The control plants were watered regularly. After 2 weeks, plants were examined and re-watered to see the recovery. The recovery rate was calculated as the number of recovered plants after re-watering to the number of total plants subjected to drought stress for each genotype.

Quantitative real-time (qRT) PCR

RNA extraction and qRT-PCR were performed as mentioned earlier. Briefly, total RNA was extracted from fresh leaf tissues using the Qiagen RNeasy Plant mini kit (Qiagen, Seoul, Korea). After treatment with DNase I, one µg of total RNA was used for the synthesis of the first strand of cDNA using Omniscript RT kit and oligo dT. The cDNA was then used as a template for running RT-PCR. Real-time PCR was performed in 48-well plate with Eco Real-time PCR System (Eco™ Illumina, San Diego, CA , USA). In each reaction, 400 ng of the template cDNA, 100 nM of forward primer and reverse primer, 10 µl of SYBR green master mix was used in a total of 20 µl reaction volume. Pathogenesis-related gene 1 (PR1), expression was studied relative to actin expression. The primer list is given in Table 1.

Promoter analysis of AtWAKL10

Promoter sequence 1.5 kb upstream of the transcription initiation site was analyzed using PlantPAN 2.0 (Chow et al., 2015). Briefly, accession number of AtWAKL10 was used to search cis-regulatory elements in the promoter using Arabidopsis thaliana weight matrix. The upstream and downstream coordinates of promoter region were X: 1500, Y: 100, Z: 500. The Arabidopsis and Rice were selected as an option for identifying conserved regions. After execution of the analysis, TFs and their binding sites within the promoter region were visualized by selecting a few key TFs. Furthermore, the conserved regions among the promoter of AtWAKL10 and its orthologs in another model plant rice were studied using Cross-species tool of PlantPAN.

Statistical analysis

For all the experiments, the data were analyzed for significance and p-value was determined using a two-tailed student’s t-test using Microsoft Excel. The level of significance was set at p ≤ 0.05 or p ≤ 0.01. The mean and standard error were calculated and compared with control. All the experiments were repeated from two to four times and representative results are presented.

Results

Loss of AtWAKL10 function results in differential responses to oxidative and nitrosative stress

T-DNA insertion in atwakl10 was genotyped to identify homozygous lines and further confirmed by examining its expression level in WT and atwakl10 plants. No AtWAKL10 expression was detected in the mutant line (Fig. 1A; Fig. S1). Cotyledon development frequency was used as a score for plant fitness. Our results suggested that the loss-of-function mutant, atwakl10, showed significantly higher CDF compared to WT under CysNO-induced nitrosative stress, however, in case of GSNO, there was no significant difference (Figs. 1B and 1C). In contrast, on MV media there was no significant difference in CDF among WT and atwakl10 plants (Fig. 1C). Interestingly, atgsnor1-3 showed significant tolerance towards MV stress (Fig. 1C). Together all these data suggest that AtWAKL10 differentially regulate different stress conditions. Under normal conditions, atwakl10 plants were phenotypically similar to WT in height however, atwakl10 showed fewer branches compared to WT (Fig. 1D).

The response of atwakl10 plants to oxidative and nitrosative stress. — Figure 1: The response of *atwakl10* plants to oxidative and nitrosative stress.
(A) Genotyping and expression of *AtWAKL10* in WT and *atwakl10* mutants. (B) Germination of *atwalk10* and WT plants on control, oxidative (MV induced) and nitrosative stress (CysNO and GSNO induced) media. (C) CDF of *atwakl10* plants under indicated stressed conditions. (D) Phenotypes of the indicated genotypes. All the data points in (C) are the mean of three replicates and the experiment was repeated about two times with similar results. The labels F+R in (A) denotes gene-specific forward and reverse primers while B denotes Sail left border primer. Error bars represent ± SE. Significant differences are represented by asterisks (Student’s t-test with 95 (*) and 99% (**) confidence levels.

Download full-size image

DOI: 10.7717/peerj.7383/fig-1

AtWAKL10 is required for basal defense

To validate the possible role of ATWAKL10 in basal defense, mutant lines, as well as WT were inoculated with virulent Pst DC3000. The atgsnor1-3 is susceptible to virulent Pst DC3000 compared to WT (Feechan et al., 2005; Yun et al., 2011). Symptoms of pathogen infection were clearly visible on infiltrated leaves in both atgnor1-3 and atwakl10 lines (Fig. 2A). The symptoms development results were also reflected in pathogenicity assay. We observed that at 0 day post inoculation (dpi), only atgsnor1-3 showed significant (p ≤ 0.001) increase in pathogen growth while no significant difference was found in atwakl10 mutants compared to WT (Fig. 2B). However, both atwakl10 and atgsnor1-3 mutant showed significant increase in bacterial growth compared to WT at 2 and 4 dpi (Fig. 2B). We hypothesized that the increased pathogen susceptibility observed in the atwakl10 line may be due to down-regulation of the salicylic acid (SA) signaling pathway, therefore, we tested Pathogenesis-related 1 (PR1) gene expression which is a marker for SA-dependent gene expression. PR1 showed significantly reduced (p ≤ 0.05) transcript accumulation in both atgsnor1-3 and atwakl10 plants overtime compared to WT (Fig. 2C). However, at 0 h post inoculation, atwakl10 showed increased PR accumulation. This suggests that the susceptible phenotype of atwakl10 may be due to down-regulation of SA-dependent PR genes.

AtWAKL10 negatively regulates basal defense. — Figure 2: *AtWAKL10* negatively regulates basal defense.
(A) Symptom development after virulent *Pst* DC3000 inoculation. (B) Pathogen growth after virulent *Pst* DC3000 inoculation and (C) *PR1* gene relative expression after attempted *Pst* DC3000 (virulent) inoculation. The data points are the mean of at least three replicates. The pathogenicity experiment was repeated four times with similar results. Error bars represent ±SE while asterisk represents significant difference compared to WT (Student’s t test). The asterisk * represents p ≤ 0.05, ** represents p ≤ 0.01 while *** represents p ≤ 0.001.

Download full-size image

DOI: 10.7717/peerj.7383/fig-2

AtWAKL10 positively regulates effector-triggered immunity

To study a possible role of AtWAKL10 in effector-triggered immunity (ETI), plants were infiltrated with avirulent PstDC3000 expressing avrB. A key defense response to restrict pathogen growth in resistant plants is the hypersensitive response (HR). Therefore, we sought to determine the pathogen-induced HR response in both WT and atwakl10 mutant plants using trypan blue staining (Feechan et al., 2005). Our results suggested an increased cell death phenotype in both atwakl10 and atgsnor1-3 plants compared to WT (Fig. 3A). Similarly, pathogen growth assay showed a significant (p ≤ 0.05 and p ≤ 0.001 respectively) increase in number of bacterial colonies in both atwakl10 and atgsnor1-3 plants compared to WT plants at 2 and 4 days after inoculation (Fig. 3B); though, there was no significant difference in bacterial growth at 0 dpi among all genotypes. We further suggested that the increased HR response in atwakl10 plants might be due to increased ROS accumulation. Therefore, we studied H₂O₂ accumulation after Pst DC3000 avrB inoculation using DAB staining. Our results suggested increased H₂O₂ accumulation in atwakl10 compared to WT (Fig. 3C). Hypersensitive response is often characterized by cell death at the site of infection. Therefore to further confirm the pathogen-induced cell death phenotype of atwakl10, electrolyte leakage was measured overtime following PstDC3000 avrB challenge. The atwakl10 plants showed more electrolyte leakage overtime compared to other genotypes studied; followed by atgsnor1-3 (Fig. 3D).

Promoter of AtWAKL10 rich in binding sites for stress response transcriptional regulators

The gene structure is crucial to study the function of a gene and plays a key role in adaptation and evolution. We, therefore, analyzed the gene structure of AtWAKL10 and found that it consists of three exons and two intronic regions (Fig. 4A). Promoter region upstream of transcription initiation site regulates mechanistic control of transcription initiation by possessing sites for binding TFs (Palmieri et al., 2008; Imran et al., 2018a). These sites also called cis-regulatory elements regulate several cellular processes. We, therefore, analyzed the promoter of AtWAKL10 1.5 kb upstream of the transcription initiation site to identify cis-regulatory elements. A number of key cis-regulatory elements were identified in the promoter region (complete list given as Table S1). Some of them were mentioned in Fig. 4B including binding sites for Arabidopsis thaliana MERISTEM LAYER1 (ATML1) a TF which is expressed in the L1 layer and is supposed to suggest the mechanism for cell fate specification (Abe, Takahashi & Komeda, 2001). Among others were AtDREB2 involved in regulation of dehydration and high salinity responsive gene expression (Nakashima et al., 2000) and AtDREB19 that enhanced plant performance without compromising phenotype under drought and salt stress (Krishnaswamy et al., 2011). Furthermore, the important w-boxes, binding sites for WRKY TFs were also present (Fig. 4B). Identification of AtWAKL10 in model crop rice showed that AtWAKL10 is similar to rice OsWAKL5 (Fig. 4C).

Promoter analysis of AtWAKL10. — Figure 4: Promoter analysis of *AtWAKL10*.
(A) Genetic structure of *AtWAKL10*. Green bars represent exons, while gaps between two exonic regions are introns. (B) Position and visualization of different transcription factor binding site (TFBS) one Kb upstream of transcription initiation site and (C) comparison of conserved regions of *AtWAKL10* and its orthologs in rice.

Download full-size image

DOI: 10.7717/peerj.7383/fig-4

AtWAKL10 positively regulates NaCl-induced salt stress

The promoter region of AtWAKL10 showed TF binding sites (TFBS) for TFs that are involved in abiotic stress responses as mentioned in the above section. We, therefore, tested if there is any possible role for AtWAKL10 in abiotic stress. Wild type and atwakl10 lines were subjected to 100 and 150 mM NaCl solution and the germination percentage was recorded after 1 week. Results suggested that at 100 mM salt solution there was no significant difference in germination percentage of atwakl10 and WT plants; whereas, germination was significantly reduced at 150 mM salt treatment (from 100% in control media to 54% in 150 mM) Figs. 5A and 5B)).

atwakl10 plants showed reduce germination percentage under high salinity conditions. — Figure 5: *atwakl10* plants showed reduce germination percentage under high salinity conditions.
(A) Germination of *atwakl10* and WT plants on different salt conditions. (B) Germination percentage in WT and mutant line after exposure to different salinity conditions. The data in the graph represents the mean of three replicates. The experiment was repeated three times with similar results. Error bars represent ± SE (n = 3). (Student’s t test). The asterisk * represents p ≤ 0.05 while ** represents p ≤ 0.01.

Download full-size image

DOI: 10.7717/peerj.7383/fig-5

atwakl10 plants exhibit increased drought tolerance

Functional characterization of downstream NO-regulated genes revealed that they play significant roles in drought stress responses (Shi et al., 2014). Furthermore, the promoter of AtWAKL10 was having TFBS for DREB19 and DREB2. DREB2 is reportedly involved in drought tolerance (Liu et al., 1998). We, therefore, investigated the response of atwakl10 plants to drought stress. Thus, WT and atwakl10 lines were exposed to drought through water-withholding for 2 weeks (Figs. 6A and 6B). Our results indicated that atwakl10 plants exhibited improved drought tolerance compared to WT (Fig. 6C). Most of the atwakl10 plants exhibited reduced wilting and recovered quickly after re-watering. In contrast, few WT plants survived the drought treatment. The recovery rate for atwakl10 plants was the highest (60%) compared to WT (0%) (Fig. 6D).

atwakl10 plants exhibit drought tolerance. — Figure 6: *atwakl10* plants exhibit drought tolerance.
(A) Phenotypes of indicated genotypes 0 days post-drought (after withholding water). (B) After 2 weeks of drought stress. (C) Phenotypes of plants after 2 weeks of drought stress, followed by re-watering. (D) Quantification of recovery rates after re-watering. The experiment was repeated twice with similar results.

Download full-size image

DOI: 10.7717/peerj.7383/fig-6

Discussion

Most biotic and abiotic stresses have a common feature: the production of oxidative and nitrosative burst and an associated change in cellular redox potential. Exposure to RNI and ROS leads to alterations in plant redox homeostasis and can even result in cell death. Therefore, it is of paramount importance to explore the role of NO in the regulation of genes involved in key plant processes. Recently, we have reported more than 6,000 genes that showed significant differential expression in response to the NO donor CysNO (Hussain et al., 2016). Among those, AtWAKL10 was one candidate gene that showed more than 124-fold induction suggesting AtWAKL10 might be linked to NO signaling during biotic and/or abiotic stress conditions. The present investigation strongly supports a role for NO in the regulation of plant defense responses to biotic and abiotic factors. WAKL10 encodes a guanyl cyclase, an enzyme that catalyzes the synthesis of cGMP from GTP (Schaap, 2005). In animals, cGMP stimulates biosynthesis of cyclic ADP-ribose and thereby serves as a further downstream messenger of NO. Guanosine 3′, 5′-cyclic monophosphate levels are modulated by NO in animal cells and equilibrium concentrations of cGMP are dependent on NO-activated guanylate cyclases (Ignarro, 2000). Our results suggested that atwakl10 plants showed enhanced tolerance to the NO donor CysNO but not GSNO (Fig. 1C). However, on both NO donors-mediated nitrosative stress conditions, the atwakl10 plants showed reduced growth and albino phenotype with more severe on GSNO-mediated nitrosative stress compared to WT. This might be because of the possible role of AtWAKL10 in RNS scavenging which may be due to its many fold induction (>124) in response to CysNO. Therefore a perturbation in the function may result more nitrosative stress which ultimately results in compromised plant growth as suggested by many reports (Corpas & Palma, 2018; Lee et al., 2008; Lindermayr, 2017). The difference in response of atwakl10 plants to different NO donors might be because of the differential accumulation of intracellular NO due to different NO release rates of NO donors (He & Frost, 2016). However, GSNO being biologically active molecule present in the cell that serves a stable reservoir of NO having the potential to modify different proteins (Frungillo et al., 2014). Further detail investigation is required to unravel the underlying mechanism of how NO regulates growth responses during nitrosative stress condition. On MV-induced oxidative stress media, both WT and atwakl10 showed reduced CDF while atgsnor1-3 showed increased tolerance with about 80% CDF percentage. The enhanced growth performance by atgsnor1-3 on MV media might be due to a strong antioxidant system in atgsnor1-3 (Kovacs et al., 2016).

We further studied the role of AtWAKL10 in basal defense and found that atwakl10 plants were more susceptible to virulent Pst DC3000, suggesting that AtWAKL10 positively regulates basal defense (Figs. 2A and 2B). Previous studies on AtWAK genes have suggested their possible role in pathogen defense responses. In Arabidopsis, AtWAK1 was induced by P. syringae as well as by exogenous SA application (He, He & Kohorn, 1998). In addition, AtWAK1 transcription is up-regulated by SAR inducing conditions (Maleck et al., 2000).

WAK/WAKL proteins comprise a transmembrane domain, a cytoplasmic serine/threonine kinases domain and an extracellular calcium-binding domain (Meier et al., 2010). The intracellular messenger cGMP is an important signaling molecule in biotic stress responses in plants. Ludidi & Gehring (2003) showed in vitro generation of cGMP from a GC motif present in an intracellular domain of the AtWAKL10 protein. WAKL has a well-documented role in regulating SA-dependent defense response (He, He & Kohorn, 1998). Few WAKL genes have been implicated in SA/JA cross-talk. The susceptibility of atwakl10 to Pst DC3000 has indicated the role of WAKL10 in defense signaling (Figs. 2A and 2B). Expression dynamics of SA responsive genes have provided evidence for the involvement of WAKL10 gene in SA responses. Further, the promoter region of Arabidopsis AtWAK and AtWAKL genes harbor binding sites for WRKY TFs (Meier et al., 2010). These reports are in accordance with our results in which we also found WRKY TFBS in the promoter region of AtWAKL10. This TF family has been extensively studied for its role in regulating the expression of defense response genes (Eulgem et al., 1999). Li, Brader & Palva (2004) described the role of Arabidopsis WRKY70 as a node of convergence between SA and JA signaling. They reported overexpression of WRKY70 caused activation of SA-induced PR genes and suppression of JA responsive PDF1.2 gene (Meier et al., 2010). Recently we have reported a member of the WRKY TF family that was regulated at the transcriptional level in response to NO, in an RNA-seq mediated transcriptome analysis (Imran et al., 2018b). To study the role of AtWAKL10 in ETI, we inoculated plants with Pst DC3000 expressing avrB effector. The ultimate response of effector-triggered immunity as a result of interaction between avr and R gene products is HR (Jones & Dangl, 2006). Though the exact mechanisms of R-avr interactions are still being investigated, the requirement of SA has been shown in many plant-pathogen interactions (Mauch-Mani & Slusarenko, 1996). Therefore, we quantified the HR response by histological staining using trypan blue. We found that atwakl10 lines showed an enhanced HR response (Fig. 3A). The HR is mostly associated with resistance to Biotrophic pathogens; however, atwakl10 plants showed a significantly greater bacterial titer compared to WT (Figs. 2B and 3B). Similarly, the atgsnor1-3 mutant line also showed increased susceptibility to virulent and avirulent Pst DC3000 with increased CFU counts (Figs. 2B and 3B). These results are in accordance with Feechan et al. (2005) and who for the first time reported that perturbation in GSNOR1 function results in a compromised defense response. One of the possible explanations for this could be the hemibiotrophic nature of Pst which even can feed and survive on dead matter and multiply as suggested by (Lee & Rose, 2010). Second, after attempted pathogen infection, the production of ROS such as superoxide (O₂^-) and H₂O₂ is one of the early events to occur. These ROS are either helping in strengthening the cell wall thereby trying to restrict pathogen invasion (Bradley, Kjellbom & Lamb, 1992) or act as a signaling molecule to induce defense response such as a rapid HR response (Alvarez et al., 1998). Therefore, we suggest that the induced HR response in atwakl10 might be due to increased pathogen-induced H₂O₂ accumulation. We, therefore, sought to determine the accumulation of H₂O₂ in WT and KO mutant lines. Our results revealed an increased accumulation of H₂O₂ in atwakl10 mutant line supporting our hypothesis (Fig. 3C).

Promoter analysis of AtWAKL10 revealed the presence of key TFBS that are involved in abiotic stress tolerance (Fig. 4B). We, therefore, tested atwakl10 plants for their possible response to salt and drought stress. The atwakl10 line showed a differential response to both stresses. In the case of salt stress, atwakl10 plants showed a reduced germination percentage at 150 mM (Figs. 5A and 5B). Literature reports have suggested that cGMP maintains a lower Na (⁺)/K (⁺) ratio and increasing the plasma membrane H(+)ATPase gene expression that reduces the injury caused by salt stress (Li et al., 2011). AtWAKL10 that encodes GC and catalyzes the synthesis of cGMP might, therefore, be important in regulating salt stress positively. Contrary to this, in response to drought stress atwakl10 plants showed a higher survival rate (Figs. 6C and 6D). The promoter of AtWAKL10 has TFBS for mostly drought-responsive genes such as DREB19, DREB2 (Liu et al., 1998) and ABA-responsive WRKY18 and WRKY40 (Fig. 4B). Previous reports have explored the role of DREBs in the regulation of abiotic stress responses including drought (Lata & Prasad, 2011). Similarly, Chen et al. (2010) reported the role of WRKY18 and WRKY40 in abscisic acid and abiotic stress responses in Arabidopsis. Transcription factors are regulatory genes that mediate the expression of genes in response to a particular stimulus. Therefore, the presence of TFBS related to drought suggests regulation of AtWAKL10 by drought-related TFs; however, the exact mechanism needs to be explored further.

Conclusions

AtWAKL10 one of the candidate genes for NO signaling showed 124.7 fold change in response to CysNO in RNA-seq based transcriptomic study (Hussain et al., 2016). Investigation into the role of AtWAKL10 in plant biology using functional genomics revealed that loss of function in AtWAKL10 resulted in no significant changes in CDF under control and oxidative stress condition whereas under CysNO mediated nitrosative stress condition it showed a significant increase in CDF compared to WT. Furthermore, AtWAKL10 showed positive regulation of basal and R-gene mediated resistance. Promoter analysis of AtWAKL10 suggested its role in abiotic stresses. We observed that AtWAKL10 positively regulates salt while negatively regulates drought stress. However, further investigation is required for dissecting the underlying pathways that combine or separates biotic and abiotic stress responses.

Supplemental Information

Original gel images presented in Fig. 1.

(A) Genotyping of atwalk10 kock out (KO) line. (B) Confirmation of KO line by studying gene expression in both wild type and KO line. (C) Actin levels in samples presented in (B).

DOI: 10.7717/peerj.7383/supp-1

Download

Complete list of TFBs in the promoter region of AtWALK10.

DOI: 10.7717/peerj.7383/supp-2

Download

[1] Abe M, Takahashi T, Komeda Y. 2001. Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein. Plant Journal 26(5):487-494

[2] Alvarez ME, Pennell RI, Meijer P-J, Ishikawa A, Dixon RA, Lamb C. 1998. Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell 92(6):773-784

[3] Begara-Morales JC, Sánchez-Calvo B, Luque F, Leyva-Pérez MO, Leterrier M, Corpas FJ, Barroso JB. 2014. Differential transcriptomic analysis by RNA-Seq of GSNO-responsive genes between Arabidopsis roots and leaves. Plant and Cell Physiology 55(6):1080-1095

[4] Beligni MV, Lamattina L. 2000. Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyl elongation, three light-inducible responses in plants. Planta 210(2):215-221

[5] Bradley DJ, Kjellbom P, Lamb CJ. 1992. Elicitor-and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell 70(1):21-30

[6] Burniston MT, Wilson DJ. 2008. Radioiodine ablation outcomes after imaging with 123I or 131I: is no news good news? Journal of Nuclear Medicine 49(1):166-167

[7] Chen H, Lai ZB, Shi JW, Xiao Y, Chen ZX, Xu XP. 2010. Roles of Arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress. BMC Plant Biology 10:281

[8] Chow C-N, Zheng H-Q, Wu N-Y, Chien C-H, Huang H-D, Lee T-Y, Chiang-Hsieh Y-F, Hou P-F, Yang T-Y, Chang W-C. 2015. PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants. Nucleic Acids Research 44(D1):D1154-D1160

[9] Corpas FJ, Palma JM. 2018. Assessing nitric oxide (NO) in higher plants: an outline. Nitrogen 1(1):3

[10] Dangl JL, Jones JDG. 2001. Plant pathogens and integrated defence responses to infection. Nature 411(6839):826-833

[11] Delledonne M. 2005. NO news is good news for plants. Current Opinion in Plant Biology 8(4):390-396

[12] Delledonne M, Xia Y, Dixon RA, Lamb C. 1998. Nitric oxide functions as a signal in plant disease resistance. Nature 394(6693):585-588

[13] Durner J, Wendehenne D, Klessig DF. 1998. Defense gene induction in tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose. Proceedings of the National Academy of Sciences of the United States of America 95(17):10328-10333

[14] Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE. 1999. Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO Journal 18(17):4689-4699

[15] Feechan A, Kwon E, Yun B-W, Wang Y, Pallas JA, Loake GJ. 2005. A central role for S-nitrosothiols in plant disease resistance. Proceedings of the National Academy of Sciences of the United States of America 102(22):8054-8059

[16] Foster MW, Liu L, Zeng M, Hess DT, Stamler JS. 2009. A genetic analysis of nitrosative stress. Biochemistry 48(4):792-799

[17] Fraccarollo D, Galuppo P, Motschenbacher S, Ruetten H, Berbner A, Schaefer A, Ertl G, Bauersachs J. 2009. No independent activation of soluble guanylyl cyclase provides additional benefit to ACE inhibition on cardiac remodeling postinfarction. Circulation 120:S852-S853

[18] Frungillo L, Skelly MJ, Loake GJ, Spoel SH, Salgado I. 2014. S-nitrosothiols regulate nitric oxide production and storage in plants through the nitrogen assimilation pathway. Nature Communications 5(1):5401

[19] Garcia-Mata C, Lamattina L. 2002. Nitric oxide and abscisic acid cross talk in guard cells. Plant Physiology 128(3):790-792

[20] Gouvêa CMCP, Souza JF, Magalhães ACN, Martins IS. 1997. NO·-releasing substances that induce growth elongation in maize root segments. Plant Growth Regulation 21(3):183-187

[21] Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, Ron D. 2003. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Molecular Cell 11(3):619-633

[22] He Z-H, Cheeseman I, He D, Kohorn BD. 1999. A cluster of five cell wall-associated receptor kinase genes, Wak1-5, are expressed in specific organs of Arabidopsis. Plant Molecular Biology 39(6):1189-1196

[23] He W, Frost MC. 2016. Direct measurement of actual levels of nitric oxide (NO) in cell culture conditions using soluble NO donors. Redox Biology 9:1-14

[24] He Z‐H, He D, Kohorn BD. 1998. Requirement for the induced expression of a cell wall associated receptor kinase for survival during the pathogen response. Plant Journal 14(1):55-63

[25] He Y, Tang R-H, Hao Y, Stevens RD, Cook CW, Ahn SM, Jing L, Yang Z, Chen L, Guo F, Fiorani F, Jackson RB, Crawford NM, Pei Z-M. 2004. Nitric oxide represses the Arabidopsis floral transition. Science 305(5692):1968-1971

[26] Hiraga H, Okubo T, Suto N, Sato K, Yamamoto T, Yoshida I, Okumura K. 1998. Nitric oxide (NO) attenuates cardiac contractility assessed by Emax in the dog heart: a study with a spontaneous NO donor. Circulation 98:257

[27] Hussain A, Mun BG, Imran QM, Lee SU, Adamu TA, Shahid M, Kim KM, Yun BW. 2016. Nitric oxide mediated transcriptome profiling reveals activation of multiple regulatory pathways in Arabidopsis thaliana. Frontiers in Plant Science 7:975

[28] Ignarro L. 2000. Nitric oxide (First Edition). Cambridge: Academic Press.

[29] Imran QM, Falak N, Hussain A, Mun B-G, Sharma A, Lee S-U, Kim K-M, Yun B-W. 2016. Nitric oxide responsive heavy metal-associated gene AtHMAD1 contributes to development and disease resistance in Arabidopsis thaliana. Frontiers in Plant Science 7:1712

[30] Imran QM, Hussain A, Lee S-U, Mun B-G, Falak N, Loake GJ, Yun B-W. 2018a. Transcriptome profile of NO-induced Arabidopsis transcription factor genes suggests their putative regulatory role in multiple biological processes. Scientific Reports 8(1):771

[31] Imran QM, Hussain A, Mun B-G, Lee SU, Asaf S, Ali MA, Lee I-J, Yun B-W. 2018b. Transcriptome wide identification and characterization of NO-responsive WRKY transcription factors in Arabidopsis thaliana L. Environmental and Experimental Botany 148:128-143

[32] Jones JDG, Dangl JL. 2006. The plant immune system. Nature 444(7117):323-329

[33] Khani M, Davidson JA, Sosnowski MR, Scott ES. 2017. Atypical growth of Phoma koolunga on cultural media and on plants artificially inoculated in environmentally controlled conditions. Australasian Plant Pathology 46(5):511-514

[34] Kovacs I, Holzmeister C, Wirtz M, Geerlof A, Frohlich T, Romling G, Kuruthukulangarakoola GT, Linster E, Hell R, Arnold GJ, Durner J, Lindermayr C. 2016. ROS-mediated inhibition of S-nitrosoglutathione reductase contributes to the activation of anti-oxidative mechanisms. Frontiers in Plant Science 7:1669

[35] Krishnaswamy S, Verma S, Rahman MH, Kav NNV. 2011. Functional characterization of four APETALA2-family genes (RAP2.6, RAP2.6L, DREB19 and DREB26) in Arabidopsis. Plant Molecular Biology 75(1–2):107-127

[36] Lata C, Prasad M. 2011. Role of DREBs in regulation of abiotic stress responses in plants. Journal of Experimental Botany 62(14):4731-4748

[37] Lee S-J, Rose JKC. 2010. Mediation of the transition from biotrophy to necrotrophy in hemibiotrophic plant pathogens by secreted effector proteins. Plant Signaling & Behavior 5(6):769-772

[38] Lee U, Wie C, Fernandez BO, Feelisch M, Vierling E. 2008. Modulation of nitrosative stress by S-nitrosoglutathione reductase is critical for thermotolerance and plant growth in Arabidopsis. Plant Cell Online 20(3):786-802

[39] Leister RT, Ausubel FM, Katagiri F. 1996. Molecular recognition of pathogen attack occurs inside of plant cells in plant disease resistance specified by the Arabidopsis genes RPS2 and RPM1. Proceedings of the National Academy of Sciences of the United States of America 93(26):15497-15502

[40] Leshem YY, Haramaty E, Iluz D, Malik Z, Sofer Y, Roitman L, Leshem Y. 1997. Effect of stress nitric oxide (NO): Interaction between chlorophyll fluorescence, galactolipid fluidity and lipoxygenase activity. Plant Physiology and Biochemistry 35:573-579

[41] Leterrier M, Chaki M, Airaki M, Valderrama R, Palma JM, Barroso JB, Corpas FJ. 2011. Function of S-nitrosoglutathione reductase (GSNOR) in plant development and under biotic/abiotic stress. Plant Signaling & Behavior 6(6):789-793

[42] Li J, Brader G, Palva ET. 2004. The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. The Plant Cell 16(2):319-331

[43] Li J, Wang X, Zhang Y, Jia H, Bi Y. 2011. cGMP regulates hydrogen peroxide accumulation in calcium-dependent salt resistance pathway in Arabidopsis thaliana roots. Planta 234(4):709-722

[44] Lindermayr C. 2017. Crosstalk between reactive oxygen species and nitric oxide in plants: key role of S-nitrosoglutathione reductase. Free Radical Biology and Medicine 122:110-115

[45] Liu L, Hausladen A, Zeng M, Que L, Heitman J, Stamler JS. 2001. A metabolic enzyme for S-nitrosothiol conserved from bacteria to humans. Nature 410(6827):490-494

[46] Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10(8):1391-1406

[47] Liu LM, Yan Y, Zeng M, Zhang J, Hanes MA, Ahearn G, McMahon TJ, Dickfeld T, Marshall HE, Que LG, Stamler JS. 2004. Essential roles of S-nitrosothiols in vascular homeostasis and endotoxic shock. Nitric Oxide-Biology and Chemistry 11:39

[48] Ludidi N, Gehring C. 2003. Identification of a novel protein with guanylyl cyclase activity in Arabidopsis thaliana. Journal of Biological Chemistry 278(8):6490-6494

[49] Madhava Rao KV, Sresty TVS. 2000. Antioxidative parameters in the seedlings of pigeonpea (Cajanus cajan (L.) Millspaugh) in response to Zn and Ni stresses. Plant Science 157(1):113-128

[50] Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KA, Dangl JL, Dietrich RA. 2000. The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nature Genetics 26(4):403-410

[51] Malik SI, Hussain A, Yun B-W, Spoel SH, Loake GJ. 2011. GSNOR-mediated de-nitrosylation in the plant defence response. Plant Science 181(5):540-544

[52] Mauch-Mani B, Slusarenko AJ. 1996. Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of arabidopsis to Peronospora parasitica. Plant Cell 8(2):203-212

[53] Meier S, Ruzvidzo O, Morse M, Donaldson L, Kwezi L, Gehring C. 2010. The Arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes. PLOS ONE 5(1):e8904

[54] Murashige T, Skoog F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15(3):473-497

[55] Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K. 2000. Organization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins involved in dehydration- and high-salinity-responsive gene expression. Plant Molecular Biology 42(4):657-665

[56] Newton RP, Smith CJ. 2004. Cyclic nucleotides. Phytochemistry 65(17):2423-2437

[57] Pagnussat GC, Simontacchi M, Puntarulo S, Lamattina L. 2002. Nitric oxide is required for root organogenesis. Plant Physiology 129(3):954-956

[58] Palmieri MC, Sell S, Huang X, Scherf M, Werner T, Durner J, Lindermayr C. 2008. Nitric oxide-responsive genes and promoters in Arabidopsis thaliana: a bioinformatics approach. Journal of Experimental Botany 59(2):177-186

[59] Parani M, Rudrabhatla S, Myers R, Weirich H, Smith B, Leaman DW, Goldman SL. 2004. Microarray analysis of nitric oxide responsive transcripts in Arabidopsis. Plant Biotechnology Journal 2(4):359-366

[60] Pasqualini S, Meier S, Gehring C, Madeo L, Fornaciari M, Romano B, Ederli L. 2009. Ozone and nitric oxide induce cGMP-dependent and -independent transcription of defence genes in tobacco. New Phytologist 181(4):860-870

[61] Plocik A, Layden J, Kesseli R. 2004. Comparative analysis of NBS domain sequences of NBS-LRR disease resistance genes from sunflower, lettuce, and chicory. Molecular Phylogenetics and Evolution 31(1):153-163

[62] Prado AM, Porterfield DM, Feijo JA. 2004. Nitric oxide is involved in growth regulation and re-orientation of pollen tubes. Development 131(11):2707-2714

[63] Schaap P. 2005. Guanylyl cyclases across the tree of life. Frontiers in Bioscience 10(1–3):1485-U1485

[64] Shi W, Liu D, Hao L, Wu C-A, Guo X, Li H. 2014. GhWRKY39, a member of the WRKY transcription factor family in cotton, has a positive role in disease resistance and salt stress tolerance. Plant Cell, Tissue and Organ Culture (PCTOC) 118(1):17-32

[65] Stamler JS, Lamas S, Fang FC. 2001. Nitrosylation: the prototypic redox-based signaling mechanism. Cell 106(6):675-683

[66] Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T, Singel DJ, Loscalzo J. 1992. S-nitrosylation of proteins with nitric oxide: synthesis and characterization of biologically active compounds. Proceedings of the National Academy of Sciences of the United States of America 89(1):444-448

[67] Suzuki N, Miller G, Morales J, Shulaev V, Torres MA, Mittler R. 2011. Respiratory burst oxidases: the engines of ROS signaling. Current Opinion in Plant Biology 14(6):691-699