NAT10 inhibits ferroptosis and promotes the progression of renal clear cell carcinoma by regulating the NFE2L1-GPX4 signaling pathway

Tissue processing

In this study, 30 cases of primary renal clear cell carcinoma and distal normal tissue adjacent to the cancer (more than five cm away from the cancer tissue) and 30 cases of normal renal tubular epithelial tissue were collected as controls. The samples were provided by the Xingtai People’s Hospital. All tissues have been pathologically diagnosed as renal clear cell carcinoma, and their diagnosis is carried out according to the standards of the World Health Organization, and is evaluated by senior experts from the pathology center. All patients had primary lesions and did not undergo preoperative radiotherapy, chemotherapy, or other anticancer treatments. The collection of tumor specimens received informed consent from patients and their families. Prior to study commencement, all experimental procedures and research objectives were thoroughly explained to participating patients and their families. Each participant voluntarily enrolled in the trial with documented informed consent agreements. Written informed consent was obtained from participants. Strict confidentiality protocols safeguarded personal information, while participants retained the unequivocal right to withdraw from the research at any stage without consequences. The study was approved by the Xingtai People’s Hospital Ethics Committee (2023 [035]).

Immunohistochemistry

The paraffin sections were placed overnight in a 65 °C oven, followed by gradient dewaxing and hydration. Then, 3% H₂O₂ solution was added and incubated at room temperature for 15 min to block endogenous peroxidase activity. The slices were placed in citrate buffer and subjected to microwave heating to repair the antigens. Normal sheep serum (5%) was added for blocking and incubated at room temperature for 15 min. Subsequently, immunohistochemistry and immunofluorescence were used to detect the target genes.

Immunofluorescence

Tissue sections were fixed in pre-cooled methanol:acetone (1:1) for 15 min at 4 °C, followed by permeabilization with 1% Triton X-100 in PBS for 10 min at room temperature to enable antibody penetration. After washing and drying, incubate overnight with NAT10, PTGS2, CHAC1, NFE2L1, and GPX4 (1:1000) antibodies in at 4 °C refrigerator. After primary antibody incubation, tissue sections were post-fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature to stabilize antibody-antigen complexes, followed by cryoprotection in 15% sucrose/PBS overnight at 4 °C for optimal structural preservation during confocal imaging. The glass slides were cleaned with deionized water and the slices were analyzed using laser confocal scanning.

For immunohistochemistry (IHC) and immunofluorescence (IF) analysis, only tubular epithelial cells (the cell type of origin of clear cell renal cell carcinoma) were stained and evaluated, excluding interstitium, inflammation, and glomerular cells. Five fields of view (40x magnification, 0.25 square millimeters per field of view) were randomly selected for each sample, and each field counted ≥ 200 cells (total ≥ 1,000 cells per sample). The staining intensity score is as follows: 0 (none), 1 (weak), 2 (moderate), or 3 (strong). The formula for calculating the percentage of positive cells is: percentage of positive = number of positive cells/amount of total number of cells × One hundred.

A composite score (range: 0–300) is obtained by multiplying the intensity score by the percentage of positivity. Adjacent normal kidney tissue with score matched to patient was standardized using the following ratio: Standardized score = tumor composite score/adjacent normal tissue composite score.

Two blinded pathologists performed the score. All immunofluorescence images contain scale bars (specified in the legend) and pseudocolor labels: NAT10 (red), GPX4 (green), DAPI (blue).

Quantitative real-time polymerase chain reaction

Thaw the frozen tumor tissue stored at −80 °C slowly on ice to avoid nucleic acid degradation caused by repeated freeze-thaw cycles. Place the tissue pieces into a pre-cooled mortar, add liquid nitrogen, and rapidly grind them into a fine powder. Transfer the powder to a centrifuge tube. Wash 110–120 supernatant to a new EP tube. Add 200 µL chloroform, vigorously vortex for 15 s, and incubate at room temperature for 5 min; centrifuge at 4 °C for 15 min. Transfer the upper aqueous phase to a new EP tube, add an equal volume of isopropanol, and mix thoroughly. Allow to stand at room temperature for 10 min; centrifuge at 4 °C for 10 min. Discard the supernatant and wash the RNA pellet twice with one mL of 75% ethanol; centrifuge at 4 °C for 5 min, discard the supernatant, and air-dry at room temperature for 5 min. Dissolve the RNA in 50 µL DEPC-treated water for reverse transcription, and store at −80 °C. Total RNA was isolated from the cultured cells using TRIzol reagent (Promega, Madison, WI, USA). After reverse transcription using a reverse transcriptase kit (TaKaRa, Shiga, Japan), we performed real-time PCR for NAT10,NFE2L1, and GPX4 using SYBR green (TaKaRa, Shiga, Japan) on a Bio-Rad PCR system (Bio-Rad, Hercules, CA, USA). The primer sequences used are listed below. Gene expression levels were calculated using the 2^−ΔΔCT method, and the data were normalized to GAPDH. The conditions are set as follows: initial denaturation at 95 °C for 10 min; denaturation at 95 °C for 10 s; annealing at 60 °C for 20 s and extension at 72 °C for 35 s. Primer information is provided in Table 1, and additional data are summarized in Table 1. The experiment was repeated three times for each group (Table 1).

Cell transfection

On the day before transfection, logarithmic ACHN and Caki1 cells were incubated overnight in a 6-well plate at a density of 3 × 10⁵/well, and antibiotic-free growth medium (2.5 mL) was added to each well. After the cell growth density reached 60%, the growth medium and add 1.5 mL of serum-free growth medium. ACHN and Caki1 cells were transfected with sh-NAT10 (50 nM) and OE-NAT10 overexpression plasmids. The sh-NAT10 constructs were based on the pLKO.1 backbone (Addgene, Watertown, MA, USA) and co-transfected with psPAX2 and pMD2.G packaging plasmids, while the NAT10 overexpression plasmid was constructed in the pcDNA3.1 backbone. Cells cultured in a carbon dioxide incubator at 37 °C for 5 h. The culture medium containing serum was changed after 48 h, and cells were collected after transfection for 36 h. The shRNA sequences targeting NAT10 were as follows:

shRNA-NAT10 (OBiO, Y29989): GAGATGTATTCACGGAATATG;

shRNA-NAT10 (OBiO, Y29990): GCAATTGTACACAGTGACTAT;

shRNA-NAT10 (OBiO, Y29991): CGGCCATCTCTCGCATCTATT;

Negative control (GL427NC2): CCTAAGGTTAAGTCGCCCTCG).

Western blotting

Caki1 cells at the logarithmic growth phase were lysed using radioimmunoprecipitation assay (RIPA) buffer. The total protein was collected by centrifugation at 12,000 rpm for 5 min at 4 °C. The protein samples were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5% skim milk for 2 h at room temperature and then washed. Subsequently, the membrane was incubated with primary antibody (diluted at 1:500) overnight at 4 °C, followed by washing. Then, it was incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody (diluted at 1:5000) for 1 h at room temperature. Protein bands were visualized using an ECL kit (P0018FS), and the grayscale values were analyzed with Image J software. GAPDH was used as the internal control to calculate the relative expression levels of NFE2L1, GPX4, ACSL4, and SLC7A11 proteins.

CCK-8 experiment

Cells were cultured at a density of 70% and collected for preparation as a 1 ×10⁴/mL cell suspension. A 96 well plate with 100 cell suspensions were added per well µL. Add 10 µL at 0, 12, 24, and 48 h respectively CCK-8 solution, incubate for 2 h, and an enzyme-linked immunosorbent assay was used to detect the absorbance value at a wavelength of 450 nm.

Cell scratch

Logarithmic growth phase cells were inoculated onto a 6-well plate, and when the cells reached 80%, a 200 µm gun was used to scratch the cover of the 6-well plate vertically. The culture medium was removed, rinsed with PBS, and fresh culture medium was added. After 36 h of cultivation, photos were taken for analysis.

Quantification of iron, malondialdehyde and reactive oxygen species

Iron: measured using an iron assay kit (I291-DOJINDO). The tissue/cell lysate was mixed with a chromogen and incubated at 25 °C for 30 min with absorbance reading at 593 nm. The results are normalized to protein concentration (µmol/g).

Malondialdehyde: detected by thiobarbituric acid active substance (TBARS) assay (AKFA013M). The sample was reacted with TBA at 95 °C for 60 min, cooled, and absorbance (nmol/mg protein) was measured at 532 nm.

ROS: cells were stained with 10 µM DCFH-DA (S0033S) at 37 °C for 30 min. Fluorescence intensity was determined by flow cytometry. Data are presented as fold changes vs. controls.

Transwell uses transwell to detect cell invasion

The diluted Matrigel matrix (1:8 ratio) was added to the upper chamber of the Transwell insert and incubated at 37 °C for 30 min to allow polymerization. Subsequently, 600 µL of complete medium containing 20% fetal bovine serum (FBS) was added to the lower chamber of a 24-well plate. Cells were serum-starved in serum-free medium for 24 h at 37 °C, trypsinized, and resuspended in serum-free medium at a density of 5 × 10⁴ cells/mL. Then, 100 µL of the cell suspension was carefully added to the pre-hydrated upper chamber. After 24 h of incubation, the non-invading cells in the upper chamber were gently removed with a cotton swab. The membrane was washed twice with phosphate-buffered saline (PBS), and the invaded cells on the lower surface were fixed with 95% ethanol and stained with 0.1% crystal violet dye (Solarbio, Beijing, China) for 20 min. The number of invaded cells was counted in five randomly selected fields under an inverted microscope at ×400 magnification.

Statistics

Data are expressed as mean ± standard error of the mean (SEM). The Student’s t-test was used for comparisons between the two groups. For multiple comparisons, data were analyzed using one-way ANOVA followed by Tukey’s post-hoc tests P < 0.05.

Expression changes of NAT10 in renal clear cell carcinoma tissue

To preliminarily explore the role of NAT10 in renal clear cell carcinoma and analyze its expression in renal clear cell carcinoma tissue, NAT10 was found to be significantly overexpressed in renal clear cell carcinoma tumor tissue (Figs. 1A–1C). Further studies have shown that the expression of NAT10 in metastatic tumors was higher than that in non-metastatic tumors (Figs. 1D–1E). Meanwhile, we carried out PCR verification of the tissues positive for NAT10 immunohistochemical detection, and the results indicated that the expression level of NAT10 mRNA was significantly increased in NAT10 positive tissues (Fig. 1F). The analysis of the prognosis of patients revealed that the survival rate of patients with elevated expression of NAT10 was poor (Fig. 1G).

NAT10 promotes the malignant biology of renal clear cell carcinoma

NAT10 promotes the malignant biological behavior of renal clear cell carcinoma. We respectively established NAT10 overexpression and knockdown cell lines (Figs. 2A–2C). Subsequently, the proliferative capacity of transfected cells was evaluated using CCK-8. The results demonstrated that overexpression of NAT10 significantly enhanced the proliferative capacity of renal clear cell carcinoma cells, whereas knockdown led to the opposite outcome (Figs. 2D–2E). Simultaneously, cell scratch and cell invasion assays were conducted to evaluate the migratory and invasive abilities of the tumor cells. These findings demonstrated that NAT10 promoted cell migration (Figs. 2F, 2G, 2H) and invasion (Figs. 2F, 2I, 2J). These results indicate that NAT10 is closely associated with the occurrence and progression of renal clear cell carcinoma.

Bioinformatics identification of ferroptosis-related genes and pathways enrichment associated with NAT10 in ccRCC

ccRCC transcriptome analysis from GEO datasets (GSE53757, GSE66271) revealed 5,888 degs between NAT10 high and low expression tumors, of which 3,198 genes were up-regulated and 2,690 genes were down-regulated. Cross-over of FerrDb’s ferroptosis-related down-regulated genes identified 177 overlapping candidate genes, many of which (e.g., GPX4, SLC7A11, FTH1) are key regulators of ferroptosis. Hierarchical clustering showed that these ferroptosis-related transcripts were significantly inhibited in the NAT10 high expression group. KEGG enrichment analysis showed that DEGs (differentially expressed genes) were significantly enriched in glutathione metabolism, oxidative stress response, NFE2L1-mediated antioxidant pathway and ferroptosis signaling, indicating that the NFE2L1-GPX4 axis is a central regulatory mechanism. These bioinformatics findings suggest that high NAT10 expression in ccRCC is associated with ferroptosis inhibition through transcriptional regulation of key antioxidant and iron metabolism pathways (Figs. 3A–3C).

NAT10 regulates the expression of ferroptosis-related proteins

To evaluate the impact of NAT10 on ferroptosis, we examined the molecular changes associated with ferroptosis after changes in NAT10. We investigated the expression of NFE2L1 and GPX4 in both normal and tumor tissues. The results demonstrated that the protein (Figs. 4A–4C) and mRNA (Figs. 4D, 4E) levels of NFE2L1 and GPX4 were significantly increased in tumor tissues, whereas the ferroptosis marker proteins PTGS2, and CHAC1 were expressed at low levels in tumor tissues (Figs. 4F–4H), however, SLC7A11 exhibited significant overexpression in tumor tissues (Fig. 4I). Malondialdehyde, a product of membrane lipid peroxidation, is positively associated with ferroptosis in cells exposed to iron. Our findings suggest that upon overexpression of NAT10, the expression of iron (Figs. 4J–4K) and MDA (Figs. 4L–4M) was significantly decreased, while with the knockdown of NAT10, the expression of iron and MDA increased significantly the same time, while the expression of ROS increased with the increase of NAT10 (Figs. 4M–4Q).

NAT10 suppresses ferroptosis via the GPX4-NFE2L1 signaling pathway

We determined the expression of GPX4 and NFE2L1 in shNAT10-ACHN and OENAT10-Caki1 cells. The results indicated that both at the mRNA (Figs. 5A, 5B) and protein (Figs. 5C–5F) levels, GPX4 and NFE2L1 decreased upon the silencing of NAT10 and increased with the overexpression of NAT10.ACHN and Caki1 cells treated with DMSO and the NAT10-specific inhibitor remodelin hydrobromide (HBr), respectively. Finally, after overexpressing NFE2L1 in ACHN and Caki1 cells and then treating the cells with HBr, the results suggested that the inhibition of GPX4 expression by HBr was partially reversed (Figs. 6A, 6B, 6E, 6F, 6G). CCK-8 results demonstrated that HBr inhibited the proliferation of ACHN and Caki1 cells. Nevertheless, overexpression of NFE2L1 partially neutralized the inhibitory effect of HBr on cell proliferation (Figs. 6C, 6D). MDA and Iron displayed the same trend (Figs. 6H, 6I). Finally, the expression of the ferroptosis marker proteins was examined. These results revealed that HBr increased the expression of PTGS2, and CHAC1. However, when NFE2L1 was overexpressed, the expression of, PTGS2, and CHAC1 weakened in ACHN (Fig. 6J) and Caki1 (Fig. 6K). The trend of SLC7A11, however, exhibited an inverse pattern compared to the aforementioned markers. These results suggest that NAT10 inhibits ferroptosis through the GPX4-NFE2L1 signaling pathway, thereby promoting the malignant progression ofccRCC.

GPX4 knockdown reverses the ferroptosis resistance induced by NAT10 overexpression

To further confirm whether GPX4 is a necessary downstream factor of NAT10, we conducted rescue experiments in Caki1 cells with NAT10 overexpression by using RSL3 to inhibit the expression of GPX4. Western blot and qRT-PCR analyses showed that after overexpressing NAT10, the protein and mRNA levels of GPX4 and SLC7A11 increased, while the protein and mRNA levels of ACSL4 decreased, indicating that NAT10 overexpression can inhibit ferroptosis. However, when a GPX4 inhibitor was added to NAT10-overexpressing Caki1 cells, the protein and mRNA levels of GPX4 and SLC7A11 decreased, while the protein and mRNA levels of ACSL4 increased, demonstrating that the ability of NAT10 to inhibit ferroptosis was significantly weakened when the expression of GPX4 was suppressed (Figs. 7A–7B). CCK-8 assays showed that after the inhibition of GPX4 expression, the enhanced proliferation caused by NAT10 overexpression was significantly reduced (Fig. 7C), and the cellular MDA levels increased (Fig. 7D). These results prove that NAT10 inhibits ferroptosis in ccRCC cells through GPX4.