N. sphaeroides phycocyanin subunit Ns-α and Ns-β improve C. elegans antioxidative capacity via ROS-related regulation

C. elegans, bacterial strain, and other reagents

Wild type Caenorhabditis elegans Bristol N2 and E. coli var strain, OP50, which initially originated from the Caenorhabditis Genetics Center (CGC), were provided by Professor Zhao’s laboratory, in the Key Laboratory of High Magnetic Field and Ion Beam Physical Biology, Chinese Academy of Sciences (Hefei, China). Fresh N. sphaeroides was initially collected from Zouma Town (29°49′N, 110°25′E) in the southwest part of Hubei province, Enshi City. The empty expression vector pCold I (simply referred as pC) was purchased from TaKaRa-Bio (Dalian, China). E. coli expression strain BL21 (DE3) harboring the constructed vectors pC-Ns-α (BL21-Nc-α) and pC-Ns-β (BL21-Nc-β) were used in this study, while the strain harboring the empty vector pC (BL21-C) was used as control bacteria in the treatments. The reagents (agar, peptone, and yeast extract) were purchased from Yuanye Biotechnology Company (Shanghai, China); the 5-Fluoro-2-deoxyuridine (FUDR) and 2,7-dichlorofluorescein diacetate (H₂DCF-DA) were purchased from Sigma–Aldrich (St. Louis, MO, USA). All reagents were of analytical grade.

Vector construction

The full-length ORF sequences from the two genes, Ns-α and Ns-β, were cloned from N. sphaeroides (maintained in our laboratory) by primer-specific PCR using total DNA as the template. Two restriction sites (NdeI and EcoR1) were designed for the recombinant plasmid pC-Ns-α and pC-Ns-β construction, leading to the gene being under the control of cspA promoter (PcspA). The PCR system was as follows: 1 μL of template DNA, 5 μL of GoTaq G2 Green Master Mix, and 1 μL of the primer mixture, supplemented with ddH₂O to a total volume of 10 μL. The reaction procedure consisted of an initial denaturation at 95 °C for 5 min, followed by denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s, extension at 72 °C for 40 s, final extension at 72 °C for 5 min, and a final hold at 16 °C for 3 min. Thirty cycles were performed for the PCR. The primers used for the Ns-α and Ns-β genes were: Ns-α-F, GGCATATGACAAAAACACCTTTAACG, Ns-α-R, GAATTCACTCTAGCTTAGAGTAT TGA; Ns-β-F, GGCATATGGTTTTAGATGCATTTG, Ns-β-R, GAATTCTTAAGCTACTGC TGAAGCA.

Ns-α and Ns-β protein expression

Two gene-expression vectors, pC-Ns-α and pC-Ns-β, were both transformed into E. coli BL21 (DE3) cells and screened on the Luria-Bertani (LB)-Ampicillin (Amp, 100 μg/mL) solid medium. A single colony was inoculated into LB-Amp liquid medium and grown with shaking at 37 °C for up to 14~16 h. The culture was then inoculated at a 1:50 dilution into fresh LB-Amp medium and grown for about 4 h at 37 °C to reach an optical cell density of approximately 0.5~0.6 at A600. For the target engineering protein induction, after 1.0 mM (final concentration) inducer isopropylthio-β-D-galactoside (IPTG) was added, the cultures were induced at 16 °C for up to 4 h. Cells were collected by centrifugation at 5,000 rpm for 10 min and washed twice with washed buffer (20 mM NaCl, 50 mM Tris-HCl, pH 7.3). The bacteria that were resuspended in 5 mL of the homogenization buffer (3–4 mL/g wet cells) were homogenized by ultra-sonication. After centrifugation (12,000 rpm, 15 min), supernatant was used as a crude extract for further isolation by His-tag affinity resin (Takara-Bio, Kyoto, Japan). The details of the method for this procedure were based on the manufacturer’s instructions (Spriestersbach et al., 2015). Samples were subjected to SDS-PAGE and demineralization. Before further assays, the concentrations of the proteins were assessed using the Bradford method (Cheng et al., 2016; Hammond & Kruger, 1988).

In vitro activity evaluation by ABTS assay

2, 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid (ABTS) assay was carried out referring to previous work from Wolosiak et al. (2021) with a little modulation. We mixed 7 mM ABTS and 2.45 mM K₂S₂O₈ with equal volumes to generate radical ABTS•+. In dark incubation at least for 12 h, the solution was further diluted with buffers of pH 3.6 and 7.4 to at Abs734. The protein solutions (40 µL) and radical solution (4,000 µL) were mixed together for 6 min, after which the Abs734 was again tested. Bovine serum albumin (BSA) was used as a control and three replications were performed for each sample. Assays for each sample were carried out in triplicate to determine the mean level.

C. elegans culture and treatment

C. elegans N2 strain were maintained at 20 °C on nematode growth medium (NGM) agar plates seeded with E. coli var strain OP50, as previously described (Buchter et al., 2020). To obtain synchronous nematodes, the gravid adults were treated using a bleaching solution (NaOH (5M), NaClO (13%); 1:1) followed by three washing steps in liquid NGM. The remaining eggs were allowed to hatch either on fresh NGM agar plates seeded with OP50 for 3 days (synchronous L4 larvae) or in 1.5 mL S-medium for 12 h (synchronous L1 larvae). For the following treatments, the larvae were fed on the suspensions containing heat inactivated bacterial mixture, such as the OP50/BL21-Ns-α or OP50/BL21-Ns-β or OP50/BL21-C, and each suspension supplemented FUDR (50 μM) to prevent nematode spawning. In the suspensions, OP50 vs BL21-cells were controlled at ratios of 1:1 or 1:3, but the whole concentration of bacteria was referred to 1.0 × 10⁹ cfu/mL. Following a 3-day treatment period, the nematodes matured into adults for subsequent assays.

Testing the body size of nematodes

To address whether the growth is affected by the two-protein treatment, the body size and stage-specific morphological characteristics were also tested. At depicted time points the nematodes in each group were transferred in 10 μL medium to a microscope slide and mixed with 10 μL of levamisole (20 mM). Images of individual nematodes were taken and analyzed to determine the length of each nematode using ImageJ (NIH, Bethesda, MD, USA).

H₂O₂ tolerance assay

For the H₂O₂ tolerance assay, the treated nematodes in each group (n ≥ 20) were respectively collected using M9 buffer and subjected to subsequent assays. Subsequently, the nematodes were exposed to 5 mM H₂O₂ in a 24-well plate, and their survival was scored at 20 min intervals under a dissecting microscopy. When treated nematodes did not respond to poking with a metal wire, they were judged to be dead. Consequently, survival was calculated as the surviving nematode ratio in the population. Each treatment was carried out in triplicate.

Endogenous ROS level

A relative fluorescence quantification method was referred to test the level of endogenous ROS of nematodes (Buchter et al., 2020). The nematodes from different groups were fed on each bacterial lawn for 24 h and collected with M9 buffer. Bacteria were removed by washing three times, and nematodes were resuspended in M9 buffer. Each 50 μL aliquot of the suspension was mixed with H₂DCF-DA (50 μL) in a 48-well plate, leading to the ROS-specific fluorescent probe H₂DCF-DA (2′,7′-dichlorodihydrofluorescein diacetate) a final concentration of 0.1 mM. Two control wells, such as that containing nematodes from each bacterial mixture lawn without H₂DCF-DA or containing H₂DCF-DA without nematodes were designed. Incubation was carried out at 25 °C for 1 h, and the nematodes were then transferred to slides, mounted with glycerol, and examined using a fluorescence microscope. ROS signal was subsequently imaged and quantified under a fluorescent microscope. The fluorescence was determined by subtracting the initial value from the final value for each well. Three independent assays were performed and for each replicate, ≥15 nematodes were assessed for the analysis.

Motility

To test the motility, L4 stage C. elegans for each treatment were cultured in S liquid medium supplemented by different bacterial suspension mixture at 20 °C shock conditions for 3 days. Subsequently, the nematodes were collected in a dish with M9 solution, and their body bends were counted every 10 s for three consecutive observations under light microscopy. Each group nematode analysis was replicated at least three times (n ≥ 20).

Lipofuscin accumulation

Treated and control group L4 stage nematodes were collected, washed with M9 buffer, anesthetized with 10 mM levamisole hydrochloride, and placed on a microscope slide. Spontaneous fluorescence was determined using fluorescence microscope (Eclipse Ni; Nikon, Tokyo, Japan; ImageJ; NIH, Bethesda, MD, USA). The treatment experiment for each sample type was repeated three times (n ≥ 10).

Total RNA extraction and quantitative real-time polymerase chain reaction

The nematodes fed different bacterial mixtures (the control group were the nematodes treated with OP50:BL-C, while the treatment groups were the nematodes treated with OP50:BL-Ns-α or Ns-β, and the ratio of the bacteria was all set as 1:1). Those sustained in the L3 stage were washed and collected in M9 buffer, and then the liquid nitrogen-treated nematodes were ground into powder for further total RNA isolation using Trizol reagent (Invitrogen, Waltham, MA, USA). Agarose gel electrophoresis was quickly performed to evaluate the total RNA quality. For each sample, after elimination of potential genomic DNA using gDNA eraser, 1.0 μg total RNA were subjected to RT-PCR using the First Strand cDNA Synthesis kit (PrimeScript^™ FAST RT reagent Kit with gDNA Eraser, RR092A; TakaRa, Tokyo, Japan) according to the manufacturer’s instructions. For the first strand cDNA synthesis, a system of 20 μL containing each essential reagent such as Random 6-mers, dNTP Mixture, and RNA was prepared on ice. The cDNA was stored at −20 °C or evaluated subsequently by analyzed Actin expression using agarose gel electrophoresis. The quantitative real-time polymerase chain reaction (qRT-PCR) using the TB Green kit (TB Green^® Premix Ex Taq^™ II (Tli RNaseH Plus), RR420L; TaKaRa, Tokyo, Japan) and StepOne Plus real-time PCR system (Applied Biosystems, Waltham, MA, USA) were then performed in our lab. Reactions were initiated at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 15 s, and 72 °C for 30 s to complete target fragments smaller than 350 bp in length, followed by melt curve analysis. At least three repeats were performed for each sample and each gene to characterize the mean level in the assay. Relative expression levels were calculated using the 2^−ΔΔCT method. The control gene Actin was used as an internal reference to normalize gene expression data. The gene-specific primers were checked to test availability using BLAST and the detail sequences are shown in Table S2.

Nucleotide sequence

The referred genome was based on the sequence of N. sphaeroides ZMS-1 submitted to GenBank and can be accessed using the species name and accession number NZ_CP031941. The genes of C. elegans described in this study can be retrieved online from NCBI (https://www.ncbi.nlm.nih.gov/) or https://wormbase.org/.

Data statistics and analysis

Statistical analyses were based on the data given as mean ± SD using PASW Statistics (SPSSInc., Chicago, IL, USA). Statistical significance was determined by one-way ANOVA and t-tests. Differences were considered to be significant at a level of P < 0.05 (“*”) or P < 0.01(“**”).

Engineering expression of Ns-α and Ns-β protein

In the context of the reported genome, the coding sequences (CDS) of the Ns-α and Ns-β genes were identified, with lengths of 492 and 522 bp and resulting in proteins containing 163 and 173 aa residues, respectively (Table S1; Fig. S1). The cysteine residues in these proteins, particularly 85Cys in Ns-α and 85Cys and 154Cys in Ns-β, are probably crucial for binding PCB (Fig. S1), and might be conferred some potential. Despite low aa sequence identities, the two subunit proteins, Ns-α and Ns-β, are each comprised of seven typical α helices and exhibit structural similarities (Fig. 1A; Table S1).

To assess their activity, the recombinant expression vectors of Ns-α and Ns-β were constructed in the context of pC (Figs. S2A and S2B). Sequenced plasmids pC-Ns-α and pC-Ns-β were respectively transformed into E. coli BL21 (DE3) cells (the engineered strains were named BL21-α and BL21-β, and the control stain harboring the empty vector pC was called BL21-C). The target strains were treated with 1.0 mM IPTG inducer, and the engineering proteins were isolated using a metal Ni affinity method targeting the 6xHis-tag in the subunits (Fig. 1B). Subsequently, the two engineering proteins were subjected to oxidation assay. In vitro experiments demonstrated that, at concentrations of 0.60 mg/mL for Ns-α and Ns-β, the scavenging ratio of ABTS·+ reached approximately 4.6% and 6.0%, respectively. After increasing the engineering protein concentrations to 1.2 mg/mL, higher inhibition levels occurred, indicating a dose-dependent manner in the testing assays (Fig. 1C). Consequently, the engineering proteins Ns-α and Ns-β exhibited anti-oxidative properties.

Ns-α and Ns-β improved nematode movement

Although phycocyanin has health benefits (Yu et al., 2017; Eriksen, 2008), further evidence is needed to determine the specific roles of the subunit proteins α and β. For this, C. elegans N2 was treated with bacterial mixture suspension of OP50 and engineered bacteria expressing Ns-α and Ns-β (OP50/BL21-α, OP50/BL21-β), while control nematodes were treated with the suspension including the same OP50 and bacteria harboring empty vector (OP50/BL21-C). The ratio of OP50 vs BL21-α and BL21-β or BL21-C in the mixture suspensions were controlled by testing the bacteria concentration. During the treatment periods, no matter whether the ratio was 1:1 or 1:3, there were no significant differences in the body length of the synchronized nematodes compared to those in the control groups (Fig. S3, P > 0.05), indicating that other potential effects were present. Notably, the motility of nematodes treated with Ns-α and Ns-β was significantly improved. For example, when the ratio was 1:1, the mean number of body bends per unit time (10 s) increased by 12% and 22%, respectively, compared to the control group (Fig. 2). After we increased the ratio of engineered bacteria in the suspensions, the motility of the nematode was slightly enhanced by 15% and 26% compared to the control, respectively. If the target bacteria were not induced by IPTG, the motilities of the nematodes from different groups displayed similarities (Fig. S4), highlighting the role of engineering Ns-α and Ns-β.

Reproduction is a particular period in a lifespan, and a precious reflection of individual physiology. The treated groups produced much fewer nematode posterities than the control group in the same period, suggesting that the intake of the two engineering proteins delayed the reproductive period of the nematodes (Fig. 3A). Under normal conditions, individual motility typically improves over time, while a decline in motility is often associated with aging. Lipofuscin, known as an aging pigment, can produce blue spontaneous fluorescence in related tissues (Di Guardo, 2015; Hohn & Grune, 2013). We found that the treated nematodes exhibited significantly lower levels of lipofuscin compared to the control group (Fig. 3B; Fig. S5). The physiological alterations in the nematodes supported the observed motility improvements during the testing periods. Therefore, it is reasonable to conclude that nematodes fed on the engineering proteins Ns-α and Ns-β were conferred enhanced motility.

Ns-α and Ns-β enhance nematode antioxidant capacity

Environmental stressors, such as oxidative stress, have significant effects on individuals and impact the aging process and disease development (Finkel & Holbrook, 2000; Venkataraman, Khurana & Tai, 2013). Elevated oxidation is closely associated with aging and diseases. To directly evaluate the antioxidative property of Ns-α and Ns-β, nematodes were treated with bacterial mixture suspension (ratio of OP50/BL21-α or -β or -C was 1:1) for up to 3 days, and then collected and subjected to 5 mM H₂O₂ to simulate oxidative stress conditions. During the testing period, nematodes that fed on the two engineering proteins demonstrated more resistance to H₂O₂-induced oxidation compared to the control group. The survival rate of nematodes treated with Ns-α and Ns-β was approximately 2.0 and 4.0 times, respectively, of that of the control group at 240 min. Even after 320 min, a significant percentage of nematodes in the treated groups remained alive, while all nematodes in the control group had perished (Fig. 4A).

ROS, which are natural byproducts of oxidative metabolism, can cause cellular damage, contributing to aging and senescence (Labunskyy & Gladyshev, 2013). Nematodes that fed on Ns-α and Ns-β exhibited increased tolerance to H₂O₂ compared to the control group, suggesting a potential modulation of endogenous oxidation levels within the nematodes. To assess ROS levels in C. elegans, the fluorescent probe H₂DCF-DA was used. Subsequently, the treated nematodes showed significant reductions in ROS levels compared to the control group (Figs. 4B and 4C), indicating that Ns-α and Ns-β facilitated the physiological modulation of ROS and enhanced the nematodes’ tolerance to H₂O₂-induced oxidation.

Nematode oxidative stress-related genes expression

The consumption of Ns-α and Ns-β has been shown to enhance tolerance to oxidation in C. elegans and their involvement in complex mechanisms. On the nutritional scale, the aa in the Ns-α and Ns-β proteins should not be ignored as any protein has no nutritional value unless it is hydrolyzed by proteases and peptidases to aa, dipeptides, or tripeptides in the lumen of the small intestine (Wu, 2016; Power, Jakeman & FitzGerald, 2013). There were one or two Cys residues in the subunit proteins, which may support their antioxidative role via potential polypeptides intake or assimilation by the nematodes. The polypeptides interact with the ROS or other regulators via multi-channels, e.g., by modulating gene expression, hence leading to the transforming of nematodes (Fig. 5).

To further investigate the antioxidative stress mechanism, total RNA was extracted from nematodes and analyzed using qRT-PCR. Genes related to oxidative stress and longevity in nematodes, such as SOD-3 (Hermeling et al., 2022; Wong, Haque & Chang, 2023), CAT-1 (Duerr et al., 1999), and DAF-2 (Kimura et al., 1997), were examined. The results revealed down-regulation of CAT-1, and SOD-3 in treated nematodes compared to the control, while SKN-1, a gene encoding a transcriptional regulator involved in oxidative stress and lifespan modulation (Kimura et al., 1997; Roy et al., 2022; Deng et al., 2020), was a little up-regulated in the treated nematodes (Fig. 6 and Fig. S6). The expression of other genes, for instance, CTL-1, was specifically and largely changed in the Ns-β treatment group but remained relatively stable in the Ns-α treatment group. SKN-1 and DAF-16 showed little alteration in both protein treatment groups compared with the control group (Song et al., 2014, 2020; Roy et al., 2022) (Fig. S6). These observed alterations in gene expression provide an initial molecular-level explanation for the antioxidant properties associated with Ns-α and Ns-β.