Berberine protects hepatocyte from hypoxia/reoxygenation-induced injury through inhibiting circDNTTIP2

Cell culture

Human normal liver cells, namely L02 cells, were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). L02 is a commonly used human normal liver cell line and could be easily obtained commercially. The cells were cultured in a 37 °C, 5% carbon dioxide incubator using DMEM medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Billings, MT, USA). The culture medium was refreshed every two to three times a week. When the cells reached approximately 80% confluence, they were detached using trypsin and subcultured at a 1:4 ratio for subsequent passages.

Establishment of hypoxia-reoxygenation cell model

L02 cells were seeded in a 6-well plate at a density of 1 × 10⁶ cells per well and allowed to incubate (Forma3111; Thermo, Waltham, MA, USA) for 24 h. Following this, the cells were exposed to an anoxic environment (37 °C, 1% O₂, 5% CO₂, and 94% N₂) for 6 h. Subsequently, they were transferred to a regular incubator set at 37 °C, 5% CO₂, and 95% air for a 6-h reoxygenation period to facilitate the subsequent experimental procedures.

Berberine pretreatment of liver cells

The L02 cells were divided into the following groups: a normal control group without H/R treatment, an H/R treatment group, and various concentrations of berberine (Sigma, St. Louis, MO, USA) pretreatment groups (0, 2, 4, 8, 16 μM berberine pretreatment for 24 h) to determine the optimal drug dose. The H/R treatment consisted of a 6-h period of hypoxia followed by 6 h of reoxygenation.

Cell transfection

The synthesized circDNTTIP2 expression plasmid, circDNTTIP2 negative control (negative control), circDNTTIP2 siRNA (sequence: TTTCCGATTTGATCAAACGACGATTA), and scramble control were provided by Guangzhou Ruibo Biological Co., Ltd (Guangzhou, China). For transfection, L02 cells were seeded in a six-well plate at a density of 1 × 10⁶ cells per well and allowed to reach 70% confluence. Transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the provided instructions.

Cell viability assay

Cell viability was evaluated using the CCK-8 method. After transfection and exposure to H/R, L02 cells were seeded in a 96-well plate at a density of 7 × 10³ cells per well. Next, 10 μL of CCK-8 reagent (C0038; Beyotime, Nantong, China) was added to each well, and the plate was incubated in the dark for 3 h. The optical density (OD) values at a wavelength of 450 nm were measured using an automatic microplate reader from Thermo Fisher Company (Waltham, MA, USA). To determine cell viability, the readings were normalized to the scramble treatment group.

Flow cytometry to detect apoptosis

Cell apoptosis was assessed using the Annexin V-FITC apoptosis kit (Beyotime, Nantong, China) following the provided instructions. Briefly, the cells were suspended in 195 µL of Annexin V-FITC binding solution. Then, 5 μL of Annexin V-FITC and 10 μL of propidium iodide (PI) were added to the suspension and gently mixed. After incubating the mixture at room temperature in the dark for 20 min, flow cytometry (CytoFLEX S; Beckman, Brea, CA, USA) was employed to analyze the apoptotic cells. Data processing and analysis were performed using CytExpert/FlowJo software.

Reactive oxygen species measurement

The quantification of intracellular reactive oxygen species (ROS) levels was performed using the ROS Assay Kit (Beyotime, Shanghai, China), which relies on the fluorescent dye DCFH-DA to measure changes in fluorescence intensity. Following the respective treatments, L02 cells were suspended in a diluted solution of DCFH-DA. The solution was prepared by diluting DCFH-DA with serum-free culture medium (Gibco, Carlsbad, CA, USA) at a 1:1,000 ratio, resulting in a final concentration of 10 μmol/L. The cell density ranged between 1.0 × 10⁶ and 2.0 × 10⁷ cells. Incubation of the cells at 37 °C in a cell incubator for 20 min allowed for DCFH-DA uptake. Afterward, the cells were thoroughly washed three times with serum-free cell culture medium to remove any unabsorbed DCFH-DA. Finally, fluorescence intensity was directly observed using a confocal laser microscope (TS-100; Nikon, Tokyo, Japan), with excitation at a wavelength of 488 nm and emission detection at 525 nm.

CircRNA sequencing

CircRNA sequencing was conducted following established protocols and procedures, as previously described (Wu et al., 2021). The Arraystar Human circRNA Microarray, capable of detecting approximately 5,816 circRNAs, was employed for comprehensive analysis of human circRNA expression. Sample labeling and chip hybridization followed the Agilent One Color Microarray Based Gene Expression Analysis protocol. mRNA isolation was performed on H/R-exposed L02 cells, with untreated L02 cells as the negative control, using the mRNA ONLY Eukaryotic mRNA Isolation Kit (Qiagen, Hilden, Germany). Enrichment and transcription of each sample into fluorescent cRNA were carried out using random primers. The labeled cRNA was then purified, and its concentration and activity were measured with the NanoDrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, the labeled cRNA was combined with blocking solution, lysis buffer, and hybridization buffer. The hybridization mixture was incubated on a glass slide in an Agilent hybrid incubator for 17 h. Following the cleaning, fixing, and scanning of the hybridization chip with the Agilent DNA Microarray Scanner, chip image analysis was performed using Agilent Feature Extraction software. Quantile standardization and data processing were conducted with the Greenspring GX software package. Further data analysis focused on selecting mRNAs with defined values, and Agilent Greenspring GX software was utilized to generate a volcano map.

RNA quantitative real-time polymerase chain reaction

Total RNA was extracted using a TRIzol kit (Invitrogen, Waltham, MA, USA) and cDNA synthesis was performed with a corresponding reverse transcription kit (Qiagen, Hilden, Germany). Real-time polymerase chain reaction (RT-PCR) was carried out on an ABI7900HT instrument (Applied Biosystems, Foster City, CA, USA) using a SYBR Green SuperMix kit (Bio-Rad, Hercules, CA, USA). The RT-PCR reaction conditions included an initial denaturation step at 95 °C for 10 s, followed by 40 cycles of amplification consisting of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s. The primer sequences are listed in Table 1.

RNase R treatment

The L02 cells subjected to H/R treatment were seeded in a six-well plate at a density of 1 × 10⁶ cells per well. After 24 h of incubation, the cells achieved a confluence of 70%. For qPCR analysis, 2 μg of total RNA was combined with 3 U/μg RNase R from Epicentre Technologies (Madison, WI, USA) and incubated at 37 °C for 15 min.

RNA binding protein immunoprecipitation

RIP was performed as previously described with some modifications (Wu et al., 2021). After a 48-h transfection period, cells were collected and subjected to lysis using RIP lysis buffer (Sigma, St. Louis, MO, USA) on ice for 10 min. Following centrifugation, the resulting supernatant was combined with 30 μl of Protein-A/G magnetic beads (Roche, Pleasanton, CA, USA) and 10 μg of caspase 3 antibody (Abcam, Boston, MA, USA) and incubated overnight at 4 °C. Subsequently, the immunocomplex was centrifuged, and the obtained pellet was subjected to three washes using washing buffer. The eluted RNA from this process was utilized for qRT-PCR analysis.

Dual-Luciferase reporter gene assay

The Dual-Luciferase reporter gene assay, based on the methods described by Wu et al. (2021) with modifications, was conducted. A recombinant vector, synthesized by Songon Biotech Corporation (Shanghai, China), containing wild-type (WT) or mutant (Mut) Caspase 3 promoter fragments corresponding to the predicted target binding site of circDNTTIP2, was used. L02 cells were transfected in a 24-well culture plate with circDNTTIP2 (800 ng) or circDNTTIP2 siRNA (20 pmol), along with either the wild-type or mutant Caspase 3 promoter (20 pmol), using Lipofectamine 2000 following the manufacturer’s instructions. After 48 h of transfection, cell harvesting was performed, and luciferase activity was measured using the Thermo Scientific Vanquish system (Thermo Fisher Scientific, Waltham, MA, USA).

Statistical analysis

Statistical analysis was performed using SPSS 16.0 software. The experimental data, obtained from three independent repetitions, are presented as mean ± SD. To assess statistical significance (P < 0.05), one-way analysis of variance (ANOVA) was conducted, followed by Bonferroni’s post-hoc test.

Berberine’s protective effect against H/R-induced injury in L02 cells

We investigated the protective effect of berberine against H/R-induced injury by evaluating cell viability, apoptosis, and ROS production in berberine pre-treated L02 cells exposed to H/R. After a 24-h pre-treatment with berberine, the cells were subjected to 6 h of hypoxia followed by 6 h of reoxygenation. H/R significantly reduced cell viability compared to the control group. However, berberine pre-treatment at concentrations of 2, 4, 8, and 16 µM increased cell viability, with the most significant effect observed at 8 µM (Fig. 1A). Therefore, we selected the 8 µM concentration for further analysis. Moreover, berberine pre-treatment reduced the occurrence of H/R-induced apoptotic cells and ROS production (Figs. 1B, 1C). Additionally, berberine pre-treatment effectively reversed the H/R-induced elevation in IL-6, IL-1β, and TNF-α levels, while restoring the decreased IL-10 expression. These results demonstrate that berberine pre-treatment protects against H/R-induced L02 cell death and regulates cytokine levels.

Berberine protect hepatocytes from H/R injury through circDNTTIP2

To investigate the underlying mechanism of berberine’s protective effect against H/R injury in hepatocytes, we performed circRNA sequencing to profile circRNA expression in H/R-treated L02 cells. Differential expression of circRNAs was observed between H/R-treated and control cells, with 1,078 circRNAs upregulated and 1,235 circRNAs downregulated in the H/R-treated cells (Fig. 2A). To validate these findings, we conducted qPCR analysis on 10 upregulated circRNAs. The results confirmed the upregulation of circ_0000117, circ_0008339, circ_0111350, circ_0016601, circ_0013218, circ_0112397, and circ_0012152 upon H/R treatment, while circ_0005199, circ_0110306, and circ_0002563 remained unchanged (Fig. 2B). Notably, circ_0013218 showed a significant over 15-fold upregulation and was designated as circDNTTIP2 due to its origin from exon 2 of the DNTTIP2 gene (Fig. 2B). The circular structure of circDNTTIP2 was further confirmed through RNase R-resistant exonuclease digestion (Fig. 2C). Interestingly, both H/R and berberine treatment did not influence the expression of DNTTIP2 mRNA. However, berberine pre-treatment attenuated the H/R-induced upregulation of circDNTTIP2 (Fig. 2D), prompting us to select circDNTTIP2 for further investigation.

Subsequently, we introduced circDNTTIP2 overexpression in L02 cells (Fig. 3A) and observed that its overexpression significantly exacerbated H/R-induced inhibition of cell proliferation and apoptosis while diminishing the protective effects of berberine pre-treatment on cell survival (Figs. 3B, 3C). Moreover, circDNTTIP2 overexpression amplified the H/R-induced expression of IL-6, IL-1β, and TNF-α, while reversing the effects of berberine pre-treatment on these genes (Fig. 3D). Additionally, circDNTTIP2 overexpression increased ROS production compared to H/R treatment alone and counteracted the effects of berberine pre-treatment (Fig. 3E). These findings suggest that berberine protects hepatocytes from H/R injury, partially by inhibiting circDNTTIP2.

circDNTTIP2 activates caspase 3 gene transcription

The involvement of caspase 3 in promoting cell apoptosis and releasing inflammatory factors during ischemia-reperfusion injury has been established in previous studies. In our investigation, we observed that overexpression of circDNTTIP2 resulted in an increased release of IL1β and IL-18. To investigate the regulatory role of circDNTTIP2 on caspase 3 expression, we assessed its impact on caspase 3 levels. Our findings confirmed that circDNTTIP2 overexpression enhanced caspase 3 expression, whereas knockdown of circDNTTIP2 reduced its expression (Fig. 4A). Subsequent analysis using the AREsite tool and BLAST analysis revealed a potential interaction between the AUAU motif of circDNTTIP2 and the TATA box in the caspase 3 promoter. To validate this interaction, we generated wild-type (caspase3-WT) and mutant (caspase3-Mut) constructs of the caspase 3 promoter. The overexpression of circDNTTIP2 significantly augmented the activity of the wild-type caspase3 promoter luciferase reporter gene, while it had no effect on the mutant caspase 3 promoter luciferase reporter gene (Fig. 4B). Similarly, knockdown of circDNTTIP2 markedly inhibited luciferase activity driven by the wild-type caspase3 promoter, but not the mutant caspase3 promoter (Fig. 4C). Furthermore, RNA pull-down analysis substantiated the physical interaction between circDNTTIP2 and caspase3 (Fig. 4D).

CircDNTTIP2 promotes H/R damage through caspase3

To investigate the relationship between circDNTTIP2 and the caspase3 pathway in liver hypoxia-reoxygenation (H/R) injury, we conducted further experiments. Our results demonstrated that depletion of circDNTTIP2 significantly mitigated the inhibitory effects of H/R on cell viability, ROS production, and cell apoptosis (Figs. 5A–5C). Remarkably, these effects were reversed by caspase3 overexpression. Furthermore, elevated caspase3 levels prominently enhanced the release of IL1β, IL6, and TNFα, which had been suppressed by circDNTTIP2 knockdown (Fig. 5D). Collectively, these findings provide strong evidence that circDNTTIP2 exacerbates H/R injury by potentiating caspase3 activity.