Comparative expression analysis of sucrose phosphate synthase gene family in a low and high sucrose Pakistani sugarcane cultivars

Introduction

The Poaceae family member sugarcane (Saccharum officinarum) is a major source of biomaterials, biofuels, and energy (Aguilar-Rivera et al., 2012). It is responsible for 80% of the global sugar yield (Ruggeri & Corsi, 2019). Unusually, the equator’s tropical and subtropical zones are crossed by the top sugarcane producing nations, which are located between 31°S and 36°N latitude. While there are 107 nations that produce sugarcane, there are 1,333 million tons of sugarcane produced worldwide. The top four producers of sugarcane worldwide are Brazil, India, China, and Thailand (FAO, 2021). It mostly thrives in tropical and subtropical regions and is one of the major C4 crops globally. The main determinants of sugarcane output worldwide are climatic occurrences rather than weather change (Msomba, Ndaki & Nassary, 2021).

Sugarcane industry is the second most important agriculture industry in Pakistan as it is cultivated on 1.06 million hectares, contributing ∼3.6% of total GDP. Whereas sugarcane accounts 4.8% of overall cropped area and plays a vital role in the economy (Qureshi & Afghan, 2005). However, due to poor irrigation and agriculture facilities, there are many snags in sugarcane cultivation. The climate of the area where sugarcane is grown plays a significant role in the development of this crop. A minimum yearly rainfall of 600 mm is required for sugarcane development in tropical or subtropical climates. Pakistan has a range of climates, from subtropical arid to semiarid, wherein sugarcane is grown in three ecological zones: the south, the center, and the northwest. With its hot and semi-humid environment, lower Sindh (in the south) is ideally suited for sugarcane cultivation.

Although the current hybrid sugarcane cultivars taste sweet enough, they still fall short of the theoretical potential in terms of sucrose accumulation percentage (Bull & Glasziou, 1963; Dal-Bianco et al., 2012; Moore & Botha, 2013). The underlying molecular pathways need to be thoroughly understood in order to improve its capacity for sucrose accumulation. The use of tissue culture for quick growth and development, transformation, molecular breeding, the introduction of novel genes for commercial purposes, the detection of sugarcane pathogens through molecular methods, the understanding of sucrose accumulation, the development of genetic maps using molecular markers, variety identification, the development of molecular testing for plant cloning, and molecular analysis are just a few of the biotechnology-based methods that have improved sugarcane production (Jones, Singels & Ruane, 2015). Few recent reviews have nicely summarized the current breeding and genomic approaches (Meena et al., 2020), and integrated genomic, phenomic and physiological strategies (Meena et al., 2022), as well as genomics selection to accelerate genetic gain (Sandhu et al., 2022) in sugarcane in terms of enhanced cane and sugar productivity.

Following photosynthesis, sucrose and other carbs are generated in plant leaves. The most prevalent type of soluble storage carbohydrate is made up of the main organic component, which may either be used directly by glycolysis or transferred via the phloem from photosynthetic tissues (the source) to non-photosynthetic tissues (the sink) (Stein & Granot, 2019). Sucrose consequently provides a key source for the direct energy generation or biosynthesis of long chains of biopolymers like starch and cellulose (Sticklen, 2008). It also acts as a supply of fixed carbon that may be supplied systemically throughout the plant. A gene network that participates in various physiological functions, including the translocation and transport of sugar, the synthesis of fiber, the movement of materials through the membrane, the function of the vacuole after development, and the tolerance to abiotic stress, controls the accumulation of sucrose during culm maturation (Casu et al., 2015).

The genotype and the enzymes including invertase, sucrose synthase (SuSy) and sucrose phosphate synthase (SPS), which carry out several crucial tasks in this crop, are some of the variables that affect the differential sucrose content in the sugarcane culm (Botha & Black, 2000). Since sucrose accounts for 75% of sugar in sugarcane, the quality of the sucrose buildup is crucial. This dynamic process involves constant cleavage and synthesis in the sugarcane’s parenchyma tissue, which is where sugar is kept in storage (Batta & Singh, 1986). Futile cycling is the process through which 22% of the stored sucrose is disassembled and then produced once more. This cycle wastes energy since ATP is needed to carry out the re-synthesis of the sucrose, which is thought to be a useful response to some environmental challenges, although it might be decreased to maximize the storage of the sucrose in sugarcane under ideal circumstances (Uys et al., 2007).

Sucrose is produced intracellularly in the cytosol where glyceraldehyde phosphate and dihydroxyacetone phosphate are transported from chloroplast. A number of enzymes, including sucrose phosphate synthase (SPS), are involved in the following reactions that are catalyzed (Pavlinova et al., 2002). SPS is essential for carbohydrate metabolism because it controls how carbon is distributed between starch synthesis and carbohydrate (sucrose) accumulation in a variety of physiological and developmental processes. Invertase activity, on the other hand continues to decline as the plant matures.

The overexpression studies show SPS as a key factor in determining how photosynthesis-derived fixed carbon is distributed throughout the plant organs (Galtier et al., 1993). The expression of SPSB gene may be important in sucrose synthesis and accumulation since S. officinarum and S. spontaneum contributed the traits of high and low sugar in grown sugarcane, respectively. Different levels of sucrose in culms might be caused by other genes or other factors that control sucrose production in stem tissue. As SPS genes are more highly expressed in S. officinarum than in other species, and because stem tissue exhibits higher levels of SPS gene expression than leaf tissue, the primary reason for the elevated sucrose concentration and reduced sucrose synthesis in stem is likely due to the presence of sugar (Ma et al., 2020).

Considering the importance of SPS as they are directly involved in sucrose metabolism, the current study was designed to get a clearer view of the extent of their involvement in sucrose metabolism and beyond. Although, a massive literature about this aspect of SPS is present, however, with the advanced in silico tools available now, we attempted to dissect the finest details of this family in sugarcane. We analyzed and compared SPS in a high and low sucrose sugarcane cultivar. A comprehensive in silico analysis of the SoSPS family displayed their phylogenetic relationship, structure of gene and protein, protein interaction network, miRNA targets, gene ontology and collinearity. The spatial expression pattern of SoSPS was also determined in sugarcane leaf and culm which was compared between the two cultivars. The phylogenetic reconstruction distributed AtSPS, ZmSPS, OsSPS, SoSPS and SbSPS into three main groups (A, B, C). The regulatory region of SoSPS genes carry ABRE, ARE, G-box, MYC as the most dominant cis regulatory elements. The predominant expression of SPS in chloroplast clearly indicates that they are the most active in the organelle which is the hub of photosynthesis. Similarly, gene ontology attributed SPS with sucrose phosphate synthase and glucosyl transferase molecular functions, and sucrose biosynthetic and disaccharide biological processes. The expression of SPS in CPF252 (high sucrose variety) was higher in leaf and culm as compared to that of CPF 251 (low sucrose variety). The details of members of this gene family, their structure and functional analysis and other factors such miRNA which regulate these genes are important prior to applied research such as gene overexpression or downregulation or even knockout. Overall, this study adds to the present literature about sugarcane, sucrose metabolism and role of SPS in sucrose metabolism and opens up further avenues of research in sugar crop improvement including sugarcane, sugar beet and others.

Materials and Methods

Results

Phylogenetic reconstruction clustered SPS in three main groups

The ML phylogenetic tree grouped the SPS family members of rice, sugarcane, Arabidopsis, maize and sorghum into three groups (blue, green, yellow) as shown in Fig. 1. The largest cluster, Group A (blue) is comprised of 19 sequences taking three out of four SoSPS (SoSPS1, SoSPS2 and SoSPS4) along with SPS from Sorghum, maize rice and Arabidopsis. SoSPS2 is clustered in Group B (green) while Group C (yellow) carrying four sequences. From the phylogenetic reconstruction, it indicates a very high similarity of sugarcane SPS with those of Sorghum and maize. Interestingly, SoSPS3 and SoSPS4 clustered together. Overall, it shows the higher similarity of orthologs in monocots (sugarcane, rice, maize, sorghum) while less similarity as compared to dicots (Arabidopsis).

Gene structure was visualized showing exons, introns and UTRs

The online tool GSDS displayed the intron-exon structure of SoSPS genes as shown in Fig. 2. The gene length ranges from ∼4.5 kb to 6.5 kb, SoSPS3 being the longest while SoSPS2, the shortest. The exons are colored in yellow boxes while introns in black lines, and blue shows 5′and 3′UTRs (Untranslated region). The number of exons/introns is almost similar as it ranges between 11 and 14. SoSPS3 and SoSPS2 both have equal number (11) of exons. Consistent with the result of phylogenetic analyses above (Fig. 1), SoSPS3 and SoSPS4 seem to be mutually very similar.

Promoter analysis of SPS genes showed specific cis motifs

Promoter sequences containing cis motifs or cis-regulatory elements are the factors defining the specificity of a gene. Besides the transcription initiation site (TATA box), various cis motifs are the sites which make genes sensitive/responsive to specific stimuli. The regulatory/promoter sequences of SoSPS genes were found to contain various cis motifs as shown in Fig. 3A. ABRE, ARE, G-box, MYC are the dominant cis elements present. Figure 3B shows some of the main elements, their sequences and function. The occurrence frequency of some prominent cis motifs indicates their function in those stresses besides their sucrose synthesizing activity.

Ten common motifs in SoSPS proteins were displayed

The sugarcane SPS proteins vary in size from 963 aa (SoSPS4) to 1,074 aa (SoSPS2). Through the online MEME tool (Bailey et al., 2009), we detected 10 common motifs in SoSPS proteins as shown below in Fig. 4. The order of all 10 motifs along the length of protein sequence is shown in Fig. 4A in various colors. The sequence of each motif from motif 1 to motif 10 is shown in Fig. 4B, while the sequence logos are shown in Fig. 4C.

SPS proteins interact with a total of 14 unique proteins

STRING database predicted the proteins interacting with all 4 SbSPS (SoSPS orthologs) as shown in Fig. 5. All of them mostly share the same set of proteins in their interaction network, however, we found a total of 14 unique protein listed in Table S1 . For each SPS, ten interacting proteins were predicted as by using default parameters in the online database.

Mitochondria and chloroplast are hotspots for SPS proteins

The in silico analysis of SoSPS genes displayed their subcellular expression in cytoplasm and various organelles. Figure 6 shows that nucleus, cytoplasm, mitochondria, and chloroplast are the hotspots of SoSPS proteins. Importantly, SoSPS2 seems highly active in nucleus, while SoSPS1 is mostly active both in nucleus and cytoplasm. SoSPS4 is more active in cytoplasm than the nucleus, while expression of SoSPS3 higher in nucleus and mitochondria as compared to cytoplasm. Overall, all of them are active in chloroplast, indicating their involvement in photosynthesis. In contrast, their expression in the rest of organelles such as Golgi bodies, endoplasmic reticulum, and vacuole is almost absent.

GO analyses attributed SPS mainly with sucrose metabolism

The gene ontology (GO) analysis termed SoSPS proteins under the two attributes including Biological Process (BP), and molecular functions (MF). Six terms for MF and 10 for BP are listed in Fig. 7. All the terms are more or less related to sucrose metabolism. In the MF, the terms such as sucrose phosphate synthetic activity and glucosyl transferase activity, while in the BP, the terms like sucrose biosynthetic process and disaccharide biosynthetic process and others clearly indicate their prominent role in sucrose synthesis.

SoSPS are more collinear to sorghum than rice SPS

Collinearity is a particular kind of synteny in which the genes are conserved in the same order. Comparisons between related eukaryotic genomes reveal various degrees to which homologous genes remain on corresponding chromosomes (synteny) and in conserved orders (collinearity) during evolution. We performed collinearity analysis in order to understand the co-localization of SoSPS genes among sugarcane, rice and sorghum as shown in Fig. 8. It is obvious that the synteny/collinearity is higher with sorghum compared to rice, as sorghum is considered the nearest relative of sugarcane.

SoSPS expression is directly related to sucrose content

The involvement of sucrose phosphate synthase in sucrose synthesis was validated by determining their spatial expression pattern and compared in CP251 and CP252 varieties. The primers used for qPCR are listed in Table 3.

Table 3:

Set of primers used for the expression profiling of SoSPS genes.

The primer, sequence (5′–3′) and product size are listed.

Primer	Sequence (5′–3′)	Product size (bp)
SoSPS1-F	GGCAAGAAATAGAACAACAATGG	160
SoSPS1-R	GGTGCTATATGACTAAACTCCAT
SoSPS2-F	GTGGGGACTGTACGATGGATTTG	160
SoSPS2-R	CCCATCAATGTCTTCAGGAACCA
SoSPS3-F	TATGGTCGTTTTATGCCTCGTAT	223
SoSPS3-R	CCAAATGCTTTTACAAGCGTAGTA
SoSPS4-F	ATTATGCCAGTGCAGGAATTGCT	339
SoSPS4-R	CCATACGAGGCATAAAACGACCA
Act-F	GTCATTATTCGATTCCGGGATAAT	249
Act-R	CTGAAAATGCAGTTAATACCAAAGC

DOI: 10.7717/peerj.15832/table-3

Figure 9 shows the expression pattern of SoSPS family. CPF252 shows overall higher expression of SoSPS as compared to CPF251. More specifically, the expression of SoSPS1, SoSPS3 and SoSPS4 is more pronounced in CPF252, with SoSPS1 and SoSPS4 relatively higher. Among the three tissues analyzed, leaf showed consistently higher expression in both varieties while bottom internode (BI) showed the lowest expression throughout. The top internode (TI) has an intermediate expression pattern; lower than leaf but higher than BI.

Discussion

The aspect of sugarcane in which the researchers put their utmost interest, either in case of sugar or bioethanol production, is the sucrose content. As mentioned earlier, the actual sucrose accumulation potential of sugarcane is far higher than field output (Dal-Bianco et al., 2012). This opens up new arena for scientists to work on sugar yield enhancement from the same sugarcane cultivation area. However, this demands a thorough understanding of how this increase could be gained. For metabolic engineering of sugarcane, the sucrose metabolic pathway needs to be tapped and understood thoroughly. The site of sucrose synthesis, its transport from source to sink, all the associated substrates and enzymes should be thoroughly studied in order to manipulate sucrose metabolic pathway thereby enhancing the sucrose yield (Perlo et al., 2020).

The highly complex polyaneuploid genome of sugarcane, which is unassembled to date, presents a major bottleneck in its molecular studies (Thirugnanasambandam, Hoang & Henry, 2018; Wang, Fang & Zhang, 2022). However, there are alternatives to study it to some extent. In case, there is less or no information regarding a species genome, it could be studied on the basis of homology to a species with an available sequenced and assembled genome. In case of sugarcane, which is actually a hybrid of Saccharum officinarum and Saccharum spontaneum (Wang, Fang & Zhang, 2021), it is usually studied on the basis of sorghum bicolor, which is currently its nearest relative (Dillon et al., 2007). The sugarcane SPS sequences were retrieved using sorghum and rice SPS sequences in search function at NCBI database, which were filtered by removing redundant sequences and finally a set of 4 unique sequences of SPS was obtained.

Sucrose is a common carbohydrate across the plant kingdom. Several gene families have been reported to contribute to the sucrose metabolic pathways including sucrose synthase, Invertase, sucrose phosphate phosphatase and sucrose phosphate synthase (SPS) (Li et al., 2021). Here we investigated the sps gene family in Saccharum officinarum, involving a comprehensive in silico analysis followed by spatial expression profiling and comparison in two sugarcane cultivars (CPF251 and CPF252).

Sucrose phosphate synthase (SPS; EC 2.4.1.14), catalyzes the transformation of fructose and UDP-glucose into sucrose-6-phosphate, which is subsequently hydrolyzed by sucrose phosphate phosphatase (SPP) to yield sucrose (López-Bucio, Cruz-Ramırez & Herrera-Estrella, 2003). Plant yield and SPS activity have been demonstrated to be inter-related (Causse et al., 1995; Prioul et al., 1999). SPS produces the substrates for sucrose phosphate phosphatase by catalyzing the conversion of fructose-6-phosphate (F-6-P) and UDP-glucose (UDP-G) to sucrose-6-phosphate (S-6-P) (SPP). The phosphate group is removed to produce sucrose in the last stage. For instance, Ricinus cotyledons at the germination stage showed a substantial turnover of the endogenous sucrose pool (Ma et al., 2020). This sucrose turnover is hypothesized to be caused by variations in the activation rate of SPS phosphorylation, which results in a fruitless cycle of concurrent synthesis and cleavage (Regmi, 2016).

SPS has an essential role in heterotrophic cells that participate in net sucrose breakdown in addition to its role in sucrose production in source leaves (Geigenberger & Stitt, 1993). Many plants contain numerous copies of the SPS gene, and since the expression of these copies varies based on the tissue types, developmental stages, and environmental signals (Hawker, 1971; Lunn, 2003; Lutfiyya et al., 2007), it is probable that the SPS genes have different roles depending on the circumstance such as various stresses including cold (Almadanim et al., 2017) and heat (Zhang et al., 2022).

As previously shown, the majority of SPS genes identified, were divided into three distinct families (A, B, and C), and it appears that the evolutionary histories of the A family and B family for dicots and monocots, respectively, are different (Langenkämper et al., 2002). A sugarcane SPS isoform and a fragmentary sequence from barley that is quite similar to it were classified in the same family, although they differed somewhat from the other known dicot SPS (Castleden et al., 2004). Consistent with these studies, in our study, the phylogenetic analysis from the proteomic sequences of sucrose phosphate synthase of sugarcane, Arabidopsis, maize, rice and sorghum clustered all members into three groups (families) A, B and C (Fig. 1), indicating a very high similarity of sugarcane SPS with those of sorghum and maize. Again, SoSPS3 and SoSPS4 clustered together, showing a very high degree of mutual similarity. Overall, it shows that the orthologs in monocots (sugarcane, rice, maize, sorghum) share more similar sequences as compared to dicots (Arabidopsis).

The synthesis of certain gene expression pathways determines cell destiny. These programs are the consequence of sequence-specific components interpreting the genomic cis-regulatory data (Rombauts et al., 2003). The decoding of this data in sequenced genomes is a problem. Therefore, it is crucial to map the cis-regulatory data underpinning transcriptional control. Sosps genes carry various cis motifs among which ABRE, ARE, G-box, MYC are prominent (Fig. 3). SoSPS plays major role in sucrose metabolism especially sucrose synthesis, however, the presence of these motifs indicates their role in stress and hormonal stimuli. This was further evidenced from their interaction network (Fig. 5). Several proteins in the interaction network of SPS were predicted. These include both downstream and upstream factors, which demonstrates that a complex process is required for sucrose accumulation involving multiple genes for targeting regulation, transport and sugar synthesis. Their further experimental characterization will make the picture clearer for manipulating or engineering of sucrose metabolic pathway.

miRNAs regulate gene expression at post-transcriptional level (Khraiwesh et al., 2010). Recent research has revealed that microRNAs regulate gene expression to govern the majority of plant biological activities (Millar, 2020). Cell differentiation has been highly correlated to the miRNA-mediated selective gene switching (Shivdasani, 2006). Under drought, several miRNAs are expressed in grass (Bhat et al., 2020). miRNA394 has been demonstrated to respond to cold stress in Arabidopsis (Bhat et al., 2020). The predicted miRNAs (Table 2) which target SoSPS should also be determined experimentally. These may play role in sucrose metabolism and their negative regulation of SPS might be the reason of low sucrose synthesis and/or accumulation in sugarcane (Dong, Hu & Zhang, 2022).

Prior to profiling the expression pattern, an in silico analysis for subcellular localization/expression of SoSPS was performed. Resultantly, the predominant expression of SPS in chloroplast (Fig. 6) clearly indicates that they are the most active in the organelle which is the hub of photosynthesis (Buchanan, 1980). Besides, they also seem active in nucleus, cytoplasm and mitochondria. Similarly, gene ontology (Fig. 7) attributed SPS with sucrose phosphate synthase and glucosyl transferase molecular functions, and sucrose biosynthetic and disaccharide biological processes. This is obvious from their expression analyses (Fig. 9). Figure 9 shows that the spatial expression pattern of SPS is consistent with previous studies (Ma et al., 2020). An earlier study reported a strong expressional preference in the stem or leaves of the two species by the clustering of the expression of SPS genes into two trends at three distinct developmental phases (seedling, pre-mature stage, and mature stage). One pattern was that the genes, including SPSB and SPSC genes at these three developmental phases, were substantially more highly expressed in leaves compared to the stem, which was consistent with prior studies (Grof et al., 2006; Ma et al., 2020). Further evidence that SPSB was the predominant gene expressed in the leaves and functional in the green tissues of the two Saccharum species came from the fact that SPSB expression was greater than SPSC. The authors also noticed that SPSA gene in S. officinarum and S. spontaneum, was expressed at levels that were noticeably greater in the stem than they were in the leaves at all developmental stages. This was in agreement to a recent work that found one sugarcane SPS gene was expressed in internodes, SPSA was the main gene exclusively expressed in the stem, especially at the mature stage (Verma et al., 2011).

Conclusions and Future Perspectives

There are several strategies to improve and enhance sucrose level of sugarcane such as breeding, genetic engineering and genome editing. Here we investigated the sucrose phosphate synthase family of sugarcane by evaluating various parameters of this gene family using online tools and bioinformatics software. Next, we determined the expression pattern of SPS and compared in two different sugarcane varieties. The phylogenetic reconstruction is consistent with the previous reports that SPS have three major categories. The presence of ABRE, ARE, G-box and other cis motifs indicate that SPS might also play role in biotic and abiotic stresses besides its basic role in sucrose synthesis. A mutational study might help in confirmation of the involvement of SPS in stresses. This is further consolidated by the predicted protein interaction network of SPS. We noticed several proteins with which SPS interact and suggest their functional validation through protein-protein interaction studies such yeast-two-hybrid assay or pull-down assay. The potential targets in the SPS for miRNAs (specially the three mentioned miRNAs) should also be validated experimentally as which miRNAs regulate them post-transcriptionally (positive/negative) and to what extent. Last but not least, the qPCR of SPS in leaves and culm suggest that the expression of SPS is relatively higher in high sucrose cultivars. The molecular research in sugarcane will get accelerated as soon as an assembled genome of the sugarcane genome becomes available.

Supplemental Information