GGA1 participates in spermatogenesis in mice under stress

Animal experiments

The Gga1-deficient mice (C57BL/6J) were a gift from Hongbin Liu (Shandong University, Jinan, China) and Wei Li (Guangzhou Medical University, Guangzhou, China). The mice were maintained under 12:12 (12-h:12-h light-dark) with a controlled temperature of 23  ± 2 °C. Animals were housed 3-5 mice per cage with free access to food and water. In the first experiment, we used 10 wildtype male mice and 10 knockout male mice to explore the effect of the Gga1 on the fertility of male mice. In the next experiment, we used six wildtype male mice and six knockout male mice to explore the effect of the Gga1 on the fertility of male mice under stress. Mice used were randomly separated into control and experimental group. Fourty four mice were used in these experiments. All mice used in the experiments were male, 2-month-old and weighed around 25 g. Two hundred micrograms BPA (239658; Sigma-Aldrich, St. Louis, MO, USA) was added into 10 mL of corn oil and then vortexed until BPA was completely dissolved, and the final concentration was 20 µg/mL. The mixture was stored at 4 °C. Mice in the BPA group were intraperitoneally injected with 40 µg/kg BPA at 5:00 p.m. daily for 2 weeks. Control group received only corn oil by intraperitoneal injection. A 40 µg/kg dose is the same for all animals, and injection volume depends on body weight. For example, a 25 g mouse needs to be injected with a dose of 1 µg/day BPA (volume: 50 µL). The BPA amount used in this study was below the US Environmental Protection Agency (EPA) safe dose of 50 µg/kg/day (Leranth et al., 2008). The primers used for genotyping were primer F1: CCACAGATACTCACCTGACACACGAG and primer R1: CATCTGATGACTGTGGGCAAAGGAG for the mutant allele (604 base pairs) and primer F2: CAGAGATGCTCTGTTTGCGCCA and primer R1: CATCTGATGACTGTGGGCAAAGGAG for the WT allele (840 base pairs). All mice were sacrificed by cervical dislocation, and then immediately dissected to seperate testicles and epididymis. For different experiments, samples were treated in different ways. Testis and epididymis were fixed in 4% PFA for histological analysis or frozen in liquid nitrogen immediately and kept at −80 °C for protein analysis. Only one epididymis per mouse was used to measure sperm motility. All the experimental procedures were carried out in accordance with the guidelines and protocols approved by the Institutional Animal Care and Use Committee (IACUC) protocols of the Institute of Zoology (IOZ-IACUC-2022-252), Chinese Academy of Sciences.

Immunoblotting

As previously reported, the tunica albuginea of the testis was peeled and seminifeuors tubules and interstitium were homogenized in mortar, supplemented with 1 mmol/L phenylmethylsulphonyl fluoride (PMSF, 0754; Amresco, Solon, OH, USA) and protease inhibitor cocktail (Roche, 04693116001; Roche Diagnostics, Rotkreuz, Switzerland) (Zhang et al., 2022). After homogenization and transient sonication, the samples were lysed on ice for 30 min. Then the samples were centrifuged at 12,000 rpm for 20 min at 4 °C. Next, the supernatants were transferred to new tubes. The total protein concentrations were determined using a BCA assay (Boster, Wuhan, China). Approximately 20 µg of total protein was separated by 10% SDS-PAGE, and then transferred to the nitrocellulose membranes. Afterward, membranes were blocked in 5% skimmed milk (DifcoTM Skim Milk, BD) at room temperature for 1 h. After washing the membranes with 1XPBS 3 times for 5 minutes each time, then, the membranes were incubated with primary antibody at 4 °C overnight and secondary antibody for 1 h at room temperature. Primary antibodies used were anti-GGA1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA, diluted 1:200), anti-Tubulin (ABclonal, Woburn, MA, USA, diluted 1:500). The secondary antibodies used were IRDye® 680CW Goat anti-Mouse (1:10000; LI-COR Biosciences, Lincoln, NE, USA) and IRDye® 800CW Goat anti-Rabbit (1:10000; LI-COR Biosciences, Lincoln, NE, USA). Next, the membranes were washed 3 times with 1XPBS, and incubated with the secondary antibodies at room temperature for 1 h. Finally, the membranes were scanned using the ODYSSEY CLx Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA).

Epididymal sperm motility and sperm count assay

Cauda epididymal sperm were released into 1ml 1X PBS and incubated for 10 min at 37 °C. The swim-up suspension was used for sperm motility analysis using a custom-made animal semen analysis system from SAS MEDICAL (Cary, NC, USA). The samples were analyzed via computer-assisted semen analysis (CASA) software developed by SAS MEDICAL (Cary, NC, USA). Sperm count was obtained using a hemocytometer.

Fertility assay

The male fertility tests were performed as previously described (Chen et al., 2021). A 2-month-old male mouse was crossed with two 8-week-old wild-type female mice. Female mice were separated and checked for copulatory plugs after mating. The plugged females were separated into individual cages for monitoring pregnancy. If a female generated no pups by day 22 postcoitus, the mice were deemed not pregnant.

Tissue collection and histological analysis

Testes and cauda epididymides were fixed in Bouin’s fixative (41506; Sigma, Waltham, MA, USA) for 24 h. Next, the tissues were dehydrated in graded ethanol and embedded in paraffin. Five-micrometer sections were cut and mounted on glass slides, then stained with hematoxylin and eosin (H&E) or periodic acid schiff (PAS). Finally, images were obtained using a Nikon Eclipse TS100 inverted microscope (Nikon, Tokyo, Japan).

Immunofluorescence and TUNEL assay

The cauda epididymal sperm samples were spread onto the surface of the slides, and then dried naturally overnight at room temperature. These slides were fixed in 4% PFA for 10 min, and permeabilized with 0.5% Triton X-100 for 10 min, and blocked in 5% bovine serum albumin (BSA, AP0027, Amresco, Boise, ID, USA) in PBS for 30 min at room temperature. Then, the slides were incubated with the fluorescent lectin peanut agglutinin (PNA, L21409, 1:400; Thermo Fisher Scientific, Waltham, MA, USA) to analyze the status of the acrosome. The cell death was measured using terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL) assay kit (In Situ Cell Death Detection Kit, 11684817910, Roche, La Posay, France), according to the manufacturer’s protocol. The nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI, D3571, Thermo Fisher Scientific, Waltham, MA, USA) for 5 min. Finally, the images were taken by a Zeiss LSM 880 microscope.

Statistical analysis

All data were presented as the mean  ± SD. Unpaired t-tests and two-way ANOVA with post hoc tests were used for statistical analysis. Differences were considered significant at P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), and P < 0.0001 (****). NS stands for not statistically significant.

Gga1^−/− male mice were successfully generated and displayed normal spermatogenesis

To investigate the function of Gga1 in spermatogenesis, we generated Gga1^−/− mice using CRISPR/Cas9 technology (Fig. 1A). Sanger sequencing and genotyping confirmed that 11,540 bp was deleted and an unexpected additional 15 bp was inserted in Gga1 gene (Figs. 1A and 1B). The immunblotting analysis showed GGA1 protein was completely absent in Gga1^−/− testis compared with Gga1^+/+ testis (Fig. 1C). These results demenstrated that we had sucessfully generated Gga1 knockout mice.

To determine whether loss of GGA1 affected reproductive system, we next examined the fertility of 2-month-old Gga1^−/− and Gga1^+/+ male mice and found no significant difference in average pups between the two groups (Fig. 1D). Other than that, Gga1^−/− mice were viable and displayed no obvious differences in development or behavior compared with Gga1^+/+ mice. The body weight, absolute testis weight, and relative testis weight of male mice were examined, and no significant differences were observed between the two groups (Figs. 1E–1G).

To examine more subtle reproductive damages, the total number of spermatozoa in the cauda epididymis was counted. The data showed that Gga1^−/− male mice had normal sperm numbers (Fig. 1H). Besides, the histological analysis revealed that the spermatogenic cells in the seminiferous epithelium of Gga1^−/− male mice were tightly arranged, and no obvious abnormalities were observed in spermatogenesis. In addition, sperm density of Gga1^−/− mice also appeared to be normal compared with those of wild-type littermates (Fig. 1I). Sperm morphology assessment was also an important criterion for evaluating sperm quality. Therefore, single-sperm immunofluorescence staining was performed and imaged using confocal microscopy. Finally, our results indicated that the sperm of Gga1^−/− male mice had normal morphology compared with Gga1^+/+ male mice (Fig. 1J). Taken together, we concluded that knockout of Gga1 had no obvious effect on development and reproduction in male mice under normal condition.

Gga1^−/− male mice became infertile after BPA exposure

It has been defined that Gga1 is located in Golgi, which is essential for acrosome formation, we speculated that Gga1^−/− mice might be more sensitive to the environmental pollutants that affect the Golgi apparatus. In order to demonstrate the role of Gga1 in spermatogenesis under stressful conditions, we treated the 2-month-old Gga1^+/+ and Gga1^−/− male mice with a low dose of BPA (40 µg/kg/day) for two weeks. Then we performed fertility tests, and found that BPA-treated Gga1^+/+ male mice were still fertile, while BPA-treated Gga1^−/− male mice were sterile (Fig. 2A). To assess mating behavior of male mice, we examined their ability to form copulatory plugs after mating. The results showed that BPA-treated Gga1^−/− male mice exhibited abnormal mounting behaviors and the percentage of plugged females was decreased significantly compared with that of wild-type mice (Fig. 2B). Besides that, BPA-treated Gga1^−/− male mice showed smaller body size and lower body weight compared with those of BPA-treated control males (Fig. 2C and 2D). Anatomical inspection revealed that the testes of BPA-treated Gga1^−/− male mice were significantly reduced in size and weight compared to those of BPA-treated Gga1^+/+ male mice (Fig. 2E and 2F). To discover the cause of male infertility and reduced testis size, furtherly, we examined the testes of Gga1^+/+ and Gga1^−/− mice by H&E staining. The histological analysis showed that Gga1^+/+ male mice exhibited normal spermatogenesis with a regular arrangement of the spermatogenic epithelium in the seminiferous tubules after BPA treatment. However, Gga1^−/− mice displayed various testicular injuries, including disordered tubular structures, aggregation of spermatogenic cells and vacuoles in seminiferous tubules. Profoundly, nuclei near the basement membrane were abnormal shaped, enlarged, and extremely dark staining (Fig. 2G). In summary, the testes of Gga1^−/− male mice exposed to BPA were damaged, along with reduced body size.

BPA-treated Gga1^−/− male mice showed decreased sperm motility and quantity and increased sperm malformations

Adequate sperm count, vigorous sperm motility, and perfect sperm morphology are key factors in normal male reproduction, and defects in these factors often lead to infertility. To explore the reason of the infertility of BPA-treated Gga1^−/− male mice, we performed a histological analysis of the caudal epididymis by H&E staining and found fewer spermatozoa in the epididymal lumen of BPA-treated Gga1^−/− mice than that of BPA-treated Gga1^+/+ mice (Fig. 3A). We next released spermatozoa from the epididymis and found that sperm numbers from BPA-treated Gga1^−/− mice were significantly lower than those of BPA-treated Gga1^+/+ mice (Fig. 3B). In addition, the percentage of motile spermatozoa decreased sharply in BPA-treated Gga1^−/− mice compared with that of BPA-treated Gga1^+/+ mice (Fig. 3C). To further examine the morphology of mature spermatozoa from the cauda epididymis, we used PNA to assess the sperm acrosomal status, and nuclei were costained with DAPI. The results showed that only few sperm deformities were detected in the BPA-treated Gga1^+/+ mice, however, BPA-treated Gga1^−/− mice showed a high rate of malformed spermatozoa, including abnormal tail or neck, no head, and abnormal head and tail. Normal sperm head with bent neck or different curly tail and abnormal sperm head with normal or curly tail were the major defect categories among abnormalities in the Gga1^−/− sperms. These results demenstrated that BPA exposure jeopardized sperm morphology of Gga1^−/− males compared with the control group (Fig. 3D). The percentage of spermatozoa with abnormal tail, neck or head were shown in (Fig. 3E). These data confirmed that BPA exposure reduced sperm quality of Gga1^−/− male mice.

Effect of BPA on spermatogenesis of Gga1^−/− mice

To evaluate BPA-induced testicular damage in Gga1^−/− mice, we thoroughly investigated the spermatogenesis in BPA-treated Gga1^+/+ and Gga1^−/− mice by PAS-hematoxylin staining (Ahmed & De Rooij, 2009) and roman numerals indicated the spermatogenic stages of the seminiferous tubule (Fig. 4A). Histological analysis revealed that the seminiferous tubules of BPA-treated Gga1^+/+ males remained well-structured and arranged in an orderly manner. However, BPA-treated Gga1^−/− males exhibited a complete disruption of spermatogenesis, including disorganized seminiferous epithelium, degenerative cell structure ranging from cellular breakdown to nuclear condensation, abnormal formation of syncytial multinucleated giant cells and increased cell death in the cycle of the seminiferous epithelium (Fig. 4A).

BPA has been reported to induce cell death in multiple studies (Guo et al., 2017; Lee et al., 2007; Urriola-Muñoz, Lagos-Cabré & Moreno, 2014). Then, we performed TUNEL assays and found that the total number of TUNEL-positive cells in testes, the percentage of TUNEL positive tubules and the average number of TUNEL positive apoptotic cells per tubule from BPA-treated Gga1^−/− males were significantly increased compared with those of BPA-treated control mice (Figs. 4B, 4C and 4D). However, there was no significant difference observed in TUNEL staining between testes from Gga1^+/+ males and Gga1^−/− males in the corn oil group (Figs. 4E and 4F). In conclusion, our results suggested that loss of Gga1 in male mice combined with BPA exposure led to considerable spermatogenic disruption with plenty of germ cell death. Thus, GGA1 may ensure normal spermatogenesis in response to harmful conditions.