Role of ELK1 in regulating colorectal cancer progression: miR-31-5p/CDIP1 axis in CRC pathogenesis

Tumor tissue obtaining

Paired normal and tumor tissues were collected from colorectal cancer patients diagnosed at The First Hospital of Jilin University. Patients who had received any previous chemoradiotherapy or targeted therapy were excluded from this study. The Ethics Committee of The First Hospital of Jilin University granted approval for tissue sampling (2022-KS-080). All participating patients offered their written informed consent to partake in the study.

Cell lineage and cell culture

Colorectal cancer cell lines, RKO (ATCC^® CRL-2577), LoVo (CCL-229™), HT29 (HTB-38™), Coco-2 (HTB-37™), and NCI-H498 (CCL-254™), as well as FHC cell line (CRL-1831™) were obtained from ATCC (Manassas, VA, USA). EMEM and Hybri-Care Medium, purchased from ATCC, was used for culture of colorectal cancer cells, supplemented with 10% FBS and 1% Penicillin-Streptomycin. The FHC cells were cultured in MEGM Kit medium (Catalog No. CC-3150; Lonza, Hayward, CA, USA) supplemented with 10% FBS. All cells were cultured at 37 °C in a 5% CO₂ atmosphere.

Real-time quantitative polymerase chain reaction (qRT-PCR)

Total RNA was extracted from tissues or cells in compliance with the manufacturer’s guidelines. A reverse transcriptase kit (Invitrogen) with oligo (dT, 20 primer) was utilized for cDNA synthesis. Ultimately, SYBR green PCR Master Mix (Qiagen, Hilden, Germany) was employed in conjunction with quantitative PCR instrument (Stratagene, Mx3000P) provided by Agilent Technologies (Agilent Technologies Inc., Carpinteria, CA, USA) for conducting PCR. The reaction mix underwent an initial denaturation at 95 °C for 2 min, followed by 40 cycles of amplification, consisting of denaturation at 94 °C for 20 s, annealing at 58 °C for 20 s, and extension at 72 °C for 20 s. GAPDH was used to normalize mRNA expression levels, and U6 was used as the internal reference to miRNA expression. Table 1 displays the primers employed for qRT-PCR. The 2^−ΔΔCt method was applied to determine relative mRNA and miRNA expression levels.

TdT-mediated dUTP nick end labeling (TUNEL) assay

To detect apoptotic cells in tumor tissues, sections of consecutive tissue were subjected to TUNEL staining that was performed using an in-situ cell death detection kit (Beyotime, Jiangsu, China). The tumor tissue sections embedded in paraffin underwent triple washes in 0.01 M PBS and were subsequently permeabilized with proteinase K for 10 min. Following another round of three washes, the sections were placed in a buffer consisting of TdT and FITC-labeled dUTP mixture, and incubated in the dark at 37 ° C for 1 h. Finally, DAPI was employed as the counterstaining agent, and the sections were observed under a fluorescence microscope.

Western blot assay

The total proteins were obtained from samples and its concentration was detected using the bicinchoninic acid protein assay (BCA; Pierce, Rockford, IL, USA). Subsequently, a 20 µg portion of protein from each extract underwent separation via Tris-glycine SDS-PAGE (4% to 20%). Afterwards, protein bands were transferred to PVDF membranes (Sigma-Aldrich, St. Louis, MO, USA), followed by a blocking with non-fat milk. Following this, the membranes experienced an 8∼10 h incubation with primary antibodies, including anti-LC3B (ab51520, Abcam, Cambridge, MA, USA), anti-Beclin 1 (ab207612, Abcam, Cambridge, UK), anti-P62 (ab109012, Abcam, Cambridge, UK), and anti-GAPDH (ab8245, Abcam, Cambridge, UK). They were subsequently incubated with the secondary antibodies (BA1055 for rabbit-sourced primary antibody, and BA1051 for mouse-sourced primary antibody, Boster, Pleasanton, CA, USA). Bands were visualized using an Enhanced Chemiluminescence Kit (ECL; Pierce, Appleton, WI, USA). Expression of GAPDH was used as internal reference to targeting proteins.

Cell transfection

To accomplish the knockdown of ELK1, plasmids designed with short hairpin RNA targeting ELK1 (siRNA ELK1) were utilized (GenePharma, Sunnyvale, CA, USA). Lipofectamine^®3000 reagent, provided by Invitrogen was employed to complete the cell transfection. Post-transfection, cells were collected after 48 h for further analysis.

Wound healing assay for cell migration

Target cells were added to each well of a 24-well plate (5 × 10⁵ cells per well) and allowed to grow for 24 h. Next, a pipette tip was used to make one scratch across the cell monolayer, with the pipette being kept as perpendicular to the horizontal line as possible. The cells were then washed three times with PBS, fresh complete medium was added, and the cells were incubated for an additional 24 h at 37 ° C in a 5% CO₂ atmosphere. Following incubation, the width of the scratch was measured, and pictures were taken.

Cell invasion detection (Transwell)

Subsequent to suspending cells in medium deprived of serum, they were added into the upper compartment within a Transwell plate (Jet Bio, Guangzhou, China) that was previously plated with Matrigel Matrix (BD Biosciences; San Jose, CA, USA). The lower chamber of the culture was supplemented with medium that contained 10% FBS, and incubated for 24 h. After incubation, the cells on the membrane’s upper surface were removed, whereas the cells located on the under-surface membrane were fixed using 4% PFA for 10 min before being incubated with 0.4% crystal violet solution. Lastly, invasive cells were imaged utilizing a digital microscope produced by Olympus (Tokyo, Japan).

Promoter sequence acquisition and transcription factor prediction

Using the UCSC database, we obtained the promoter sequence of miR-31-5p ( −5000 bp). Subsequently, we identified potential transcription factors that may bind to the miR-31-5p promoter sequence by utilizing the JASPAR database at http://jaspar.genereg.net/. The binding site of ELK1 on miR-31-5p sequence was shown in (Supplementary File S1).

Identifying miR-31-5p target genes

To identify the target genes of miR-31-5p, Targetscan online tool (https://www.targetscan.org/vert_80/) was used with a criterion of Total context++ score less than −0.2, resulting in the identification of 358 genes. These genes were then categorized into three groups: oncogenes, anti-oncogenes, and unknown factors. Focusing on anti-oncogenes, the Kaplan–Meier Plotter online tool (http://kmplot.com/analysis/index.php) was employed to conduct survival analysis, in order to select factors significantly associated with colorectal cancer prognosis. Further clinical sample validation was performed on the selected factors, and the gene with the lowest expression in cancer tissues was chosen as the target gene.

Dual-luciferase reporter assay

The binding site of miR-31-5p on the CDIP1 3′-UTR was predicted using Targetscan. The CDIP1 3′-UTR sequence containing miR-31-5p binding sites cloned using PCR with primers (forward: TATCCTGCCACTGTCCTTCC, reverse: CCCGACTCTGGTTTGGTTTA). To create a wild-type reporter vector (wild type, WT), the amplified product was inserted into the psi-check2 vector (Promega, Madison, WI, USA). Furthermore, luciferase reporters with the predicted binding sites of miR-31-5p in the CDIP1 3′-UTR sequence were created to generate a mutant-type reporter vector (mutant type, MUT). Lipofectamine 3000 was employed to co-transfect the miR-31-5p mimics/miR-31-5p inhibitor in the reporter vectors into 293T cells, and the Dual-Luciferase Reporter System (Promega, Madison, WI, USA) was used to measure luciferase activity.

ChIP assay

The EZ-Magna-ChIP HiSens Kit (17-10461; Burlington, MA, USA) protocol was followed to conduct ChIP assays. In brief, RKO cell extracts were sonicated three times for ten cycles of 30 s ON/30 s OFF on ice using the Bioruptor^® PLUS sonication device set at the HIGH-power position (H). Immunoprecipitation (IP) of cross-linked protein/DNA complexes was accomplished using magnetic protein A/G beads. ELK1 antibodies (1:25) or control IgG (1:25) were used to immunoprecipitate the cleaved DNA. The fragments of the miR-31-5p promoter contained in the precipitated DNA were detected using qRT-PCR, and the fold enrichment was calculated in comparison to the input DNA.

Establishment of a xenograft nude mouse model

Six-week-old female BALB/c nude mice were purchased from the Animal Center of Jilin University, and subsequently housed under specific pathogen-free conditions (22 ° C, ∼50% humidity). Twelve mice were randomly assigned to 4 separate groups: Blank group, NC group, ELK1 siRNA group, and ELK1 siRNA+miR-31-5p. RKO cells were treated with ELK1 siRNA and miR-31-5p mimics. After being treated for 48 h, RKO cells were harvested and subcutaneously injected into the right anterior armpit of each nude mouse, with a total infusion volume of 50 µL of PBS and a concentration of 1 × 10⁶ RKO cells. Tumor growth was monitored over the next 28 days, and the weight of the tumors was recorded following the sacrifice of the mice. The animal studies were performed in compliance with the guidelines established by The First Hospital of Jilin University Animal Care and Use Committee (Approval No. 20200712).

Hematoxylin & eosin (H&E) staining

H&E staining was performed according to the description by Li et al. (2021). Briefly, the sections were immersed in hematoxylin staining solution for a 15-min duration, followed by exposure to eosin solution. Once gradient alcohol dehydration and xylene transparency treatments were performed, the tissue sections’ pathological features were examined using a microscope (Olympus, Tokyo, Japan).

Initially, tissue specimens were embedded in paraffin, from which 4-µm thick slices were obtained and subsequently dewaxed using dimethylbenzene.

Statistical analysis

IBM SPSS Statistics for Windows, Version 20 software (IBM Corp, Armonk, NY, USA) was utilized for the statistical analysis of all data sets, and the results are presented as the mean value ± standard deviation (SD). The Shapiro–Wilk test was used to determine the normal distribution of the data. To compare the data between two groups, Student’s t-test was employed, while one-way ANOVA followed by Dunnett’s T3 test was utilized for analyzing differences between more than two groups. For non-parametric data, the Whitney U test was utilized. A P-value below 0.05 indicated a statistically significant difference.

Expression characteristic of miR-31-5p in CRC tissues and cells

To verify the expression of miR-31-5p in colorectal cancer, we collected samples of CRC and adjacent normal intestinal tissue and determined their levels of miR-31-5p expression via qRT-PCR (Fig. 1A). The results showed that miR-31-5p was expressed at significantly higher levels in the tumor tissues than in the normal tissues. Next, miR-31-5p expression in FHC, and the CRC cell lines (NCI-H498, RKO, LoVo, HT29, and Coco-2) was examined by qRT-PCR (Fig. 1B). The results showed that miR-31-5p was expressed at much higher levels in two of the colorectal cancer cell lines (RKO and LoVo) than in the normal colon epithelial cells.

Inhibition of miR-31-5p affected CRC line metastasis, autophagy, and apoptosis

Considering miR-31-5p’s overexpression in CRC clinical tissues and cells, we investigated its implications in colorectal cancer cells. We effectively inhibited miR-31-5p in RKO and LoVo cells by treatment with miR-31-5p inhibitor, a procedure which was further validated by qRT-PCR analysis (Fig. 2A). Results showed that miR-31-5p altered cell migration (Fig. 2B), cell invasion (Fig. 2C), cell autophagy (Fig. 2D), and cell apoptosis-related proteins of CRC cells (Fig. 2E) were detected, respectively. Our results showed that inhibition of miR-31-5p decreased cell migration and invasion, and increased the levels BAX protein (Fig. 2F) and also the levels of caspase 3, caspase 9, caspase 11 activity (Figs. 2G, 2H, 2I) in both of the colorectal cancer cell lines. As for cell autophagy, inhibition of miR-31-5p dramatically increased cell autophagy.

ELK1 bound to the miR-31-5p promoter and mediated miR-31-5p gene transcription

To explore the effects of miR-31-5p in colorectal cancer, we first examined whether the transcription factor ELK1 binds with miR-31-5p. Lysates from CRC cells were mixed with biotinylated probes against the miR-31-5p promoter, and immunoblotting was used to detect the levels of ELK1 protein. EMSA assays showed that the biotin-labeled miR-31-5p promoter could bind with ELK1 protein, while the mutated miR-31-5p promoter failed to pull down ELK1 protein (Fig. 3A). Lysates of colorectal cancer cells were subjected to immunoprecipitation (IP) with antibodies against human IgG and anti-ELK1, and then analyzed by qRT-PCR by using primers specific for the miR-31-5p promoter. ChIP assays also showed binding between ELK1 and the miR-31-5p promoter (Fig. 3B). Additionally, as shown in Fig. 3C, ELK1 overexpression significantly increased the transcriptional activity of miR-31-5p, while ELK1 overexpression did not alter luciferase activity in miR-31-5p promoter mutated cells. These results suggested that ELK1 binds to the miR-31-5p promoter and mediates its transcription.

Effect of ELK1/miR-31-5p axis on CRC cell phenotypes

As aforementioned, ELK1 regulates miR-31-5p gene transcription by recognizing and binding with its promoter. The dynamic effects of ELK1 and miR-31-5p were explored in vitro. We treated RKO and LoVo cancer cells with ELK1 siRNA and miR-31-5p mimics. As shown in Fig. 4A, miR-31-5p expression was significantly lower in the ELK1-interferenced cells than in the siRNA control cells, indicating that the miR-31-5p mimic significantly increased miR-31-5p expression in the ELK1-interferenced cells. ELK1 expression was significantly lower in ELK1-interferenced cells than in siRNA control cells, and miR-31-5p mimics failed to alter ELK1 expression in the ELK1-interferenced group (Figs. 4A, 4B). Next, cell migration (Fig. 4C), cell invasion (Fig. 4D), and cell autophagy activity (Figs. 4E and 4F), as well as the levels of cell apoptosis-related proteins (Fig. 4G), and caspase 3 (Fig. 4H), caspase 9 (Fig. 4I) and caspase 11 (Fig. 4J) were measured, respectively. Knockdown of ELK1 significantly decreased cell migration and cell invasion, while miR-31-5p overexpression dramatically attenuated the effects of ELK1 interference. In addition, inhibition of ELK1 dramatically promoted cell apoptosis activity and autophagy, while miR-31-5p overexpression partially rescued the effects of ELK1 knockdown on cell apoptosis and autophagy.

MiR-31-5p bound to the CDIP1 3′-UTR

To explore the mechanism underlying the function of miR-31-5p in colorectal cancer progression, we used the online website TargetScan (http://www.targetscan.org/vert_71/) to predict the binding site between miR-31-5p and the CDIP1 3′-UTR. To confirm the binding site, we constructed two different types of CDIP1 3′-UTR luciferase reporter vectors; wild-type, and mutant-type, respectively (Fig. 5A). Our results showed that overexpression of miR-31-5p markedly downregulated, whereas miR-31-5p inhibition upregulated the luciferase activity of the wild-type-CDIP1 3′-UTR vector, while MUT (mutant type) of binding site on 3′ UTR of CDIP1 failed to alter luciferase activity (Fig. 5B).

Overexpression of CDIP1 affected colorectal cancer cell metastasis, autophagy, and apoptosis

CDIP1 expression was overexpressed in RKO and LoVo cells, and subsequent immunoblotting confirmed the CDIP1 overexpression efficiency (Fig. 6A). After transfection for 48 h, the levels of caspase 3, caspase 9, and caspase 11 activity (Figs. 6B–6D) in colorectal cancer cells were measured. Those results showed that overexpression of CDIP1 increased the levels of caspase 3, caspase 9, and caspase 11 activity. Next, assays for cell migration (Fig. 6E), cell invasion (Fig. 6F), and cell autophagy (Fig. 6G) were conducted, and the results showed that CDIP1 inhibited the invased and migrated of CRC cells. Cell autophagy was detected by TEM, along with western blotting assay, and results showed that CDIP1 overexpression promoted cell autophagy (Figs. 6G and 6H).

Dynamic effects of miR-31-5p and CDIP1 siRNA on colorectal cancer cell phenotypes

Since miR-31-5p binds to the CDIP1 3′-UTR, while whether miR-31-5p/CDIP1 alter CRC cell phenotypes remain unknown.

After transfection for 48 h, miR-31-5p expression was measured by qRT-PCR (Fig. 7A). As shown in Figs. 7B and 7C, we found that inhibition of miR-31-5p suppressed the migration and invasion of colorectal cancer cells, and those effects were reversed by CDIP1 siRNA. Furthermore, these results, including TEM and western blotting assay showed that the promotive effect of the miR-31-5p on autophagy could be reversed by CDIP1 siRNA (Figs. 7D and 7E). Additionally, as shown in Figs. 7F and 7G-7I, both Bax expression, and caspase 3, caspase 9, and caspase 11 activity were enhanced in the inhibitor-treated cells. However, the pro-apoptotic role of the miR-31-5p inhibition was abolished partially by treatment with CDIP1 siRNA (Figs. 7F–7G).

Dynamic effects of ELK1 and miR-31-5p on the tumorigenesis ability of colorectal cancer cells in nude mice

To further confirm the in vivo effects of ELK1 and miR-31-5p on colorectal cancer, we established a subcutaneous xenograft tumor mouse model. Colorectal cancer cells were subcutaneously injected into nude mice. As shown in Fig. 8, tumor growth was attenuated by ELK1 siRNA, and the attenuation effect was reversed by the miR-31-5p mimics (Figs. 8A–8C). H&E staining showed that in the ELK1 siRNA-treated tumor tissues, there were larger areas of necrotic tissue that showed positive TUNEL staining, while miR-31-5p treatment reduced the areas of necrotic tissue and shrunk the TUNEL-positive areas (Figs. 8D and 8E). ELK1 expression was obviously suppressed in the tumors of animals in the ELK1 siRNA group, which caused a downregulation of miR-31-5p expression and upregulation of CDIP1. Treatment with miR-31-5p mimics significantly down-regulated CDIP1 expression level in the tumor tissues; however, it had no significant effect on ELK1 expression (Figs. 8F–8H). This result was confirmed by western blotting as shown in Fig. 8I. Furthermore, ELK1 siRNA induced increases in caspase 3, caspase 9, and caspase 11 activity, while miR-31-5p suppressed the activity of those proteins (Figs. 8J–8L). When taken together, our in vivo experiments demonstrated how the effects of ELK1 and miR-31-5p interactions affected the tumorigenesis ability of colorectal cancer cells.

Limitations

However, this study has some limitations that should be considered. First, more clinical samples should be collected for detecting expression of the ELK1/miR-31-5p/CDIP1 axis, and the expression correlations should be analyzed. In addition, the correlations between ELK1 expression and various clinicopathologic features deserve further clinical analysis.