Zinc solubilizing bacteria and their potential as bioinoculant for growth promotion of green soybean (Glycine max L. Merr.)

Isolation of zinc-solubilizing bacterial strains

Rhizosphere soil samples were obtained from peanut (Arachis hypogaea L.), sweet potato (Ipomoea batatas L.) and cassava (Manihot esculenta L.) fields in Kanchanaburi, Chonburi and Rayong Provinces, Thailand, for the isolation and screening of Zn-solubilizing bacteria. The samples were collected from December 2020 to February 2021. Soil around the rhizosphere of plants at a depth of 10 to 15 cm was collected in sterile, dry polythene bags and transported to the laboratory for further analysis within 6 to 8 h after collection. The soil samples were ground into a powder after being air-dried. The soil sample containers were then filled with sterile water and agitated for two hours at 150 rpm. After that, the samples were allowed to settle for 5 min before being serially diluted up to 10⁶ times in one mL of suspension. Each dilution was applied to a nutrient agar plate and incubated at 30 ± 2 °C. The growing colonies were inspected, and bacterial colonies with various morphologies, such as white and creamy, yellowish white, smooth, glistening, rhizoid and opaque colonies, were chosen and purified using nutrient agar streaking.

Zn solubilization assay

The ability to solubilize zinc was evaluated on Bunt and Rovira’s agar, and the pH was maintained at 7.2. Different sources of insoluble zinc salts, such as zinc oxide (ZnO) and zinc carbonate (ZnCO₃) were supplemented individually at a final concentration of 0.1% to the medium, and the resulting medium was sterilized at 121 °C for 20 min. All tested strains were point inoculated onto the medium, and the plates were incubated at 30 ± 2 °C for 10 days. Strains with a distinct zone around the colony were termed zinc-solubilizing. The halo zone was measured, and the zinc solubilization efficiency (ZSE) of the strains was calculated as described by Yasmin et al. (2021) using the following equation:

ZSE = (HZ/C) ×100, where ZSE is the Zn solubilization efficiency, HZ is the diameter of the solubilization halo zone, and C is the diameter of the colony.

Determination of soluble Zn

The quantitative measurement of soluble zinc was performed in a 150 mL conical flask containing 50 mL of Bunt and Rovira’s medium and 0.1% ZnO, which was incubated at 30 ± 2 °C with 150 rpm shaking. Ten percent log-phase inoculum was used. Uninoculated medium was used as a control. After 10 days of cultivation, cells were removed by centrifugation at 10,000 rpm for 10 min. The supernatant was collected and digested with HNO₃ and HClO₄ (1:4 v/v). To measure the quantity of soluble zinc, the digested sample was analyzed using an atomic absorption spectrophotometer (Agilent Technologies 200 Series AA, USA).

Identification of selected strains

Morphological characteristics and Gram staining were carried out for identification. Then, the selected bacterial strains were identified through 16S rRNA gene sequencing. Genomic DNA (gDNA) was isolated from bacterial isolates using the GF-Bacterial DNA Extraction kit (Vivantis, Selangor, Malaysia) according to the manufacturer’s instructions. The gDNA was visualized using agarose gel electrophoresis, and the concentration of gDNA was determined using a NanoDrop DS-11 Series Spectrophotometer (DeVonix Inc., Wilmington, DE, USA). The 16S rRNA gene was amplified using the extracted gDNA. The primers fD1 (5′AGAGTTTGATCCTGGCTCAG 3′) and rP2 (5′ACGGCTACCTTGTTACGACTT 3′) were used for amplification of the 16S rRNA gene using polymerase chain reaction (PCR) (Weisburg et al., 1991). The PCR products were run on an agarose gel containing 1.5% agarose, purified using the GF-1 PCR Clean-up kit (Vivantis, Selangor, Malaysia), and sequenced commercially (1st BASE, Singapore). The 16S rRNA gene sequences of bacterial isolates were analyzed at the NCBI (the US National Center for Biotechnology Information) using BLAST against 16S ribosomal RNA sequences to determine the closest homologs. The 16S rRNA sequences with homologs showing 100% or 99% shared identity were chosen. The sequences of closely related type strains from the GenBank database were multiple-aligned using ClustalW in BioEdit Sequence Alignment Editor 7.2.5 for phylogenetic analysis (Hall, 1999). After removing gaps and ambiguous nucleotides from the sequences and performing multiple alignments, a phylogenetic tree was created using the maximum likelihood (ML) procedure in MEGA version 11 (Kumar et al., 2018) based on a comparison of 1,381–1,439 nucleotides present in all the strains. The sequence of Escherichia coli ATCC 11775^T (X80725) was used as an outgroup. Branches of the phylogenetic tree were assigned confidence levels using bootstrap analyses based on 1,000 resamples (Felsenstein, 1985).

In vitro screening for growth promotion properties of Zn-solubilizing isolates

For the production of indole-3-acetic acid (IAA), Zn-solubilizing bacteria were inoculated into LB broth with 1% L-tryptophan as an IAA precursor, and the culture was grown for 96 h at 120 rpm and 30 ± 2 °C. Cells were separated from the suspension by centrifugation at 10,000 rpm for 10 min. Then, Salkowski’s reagent was added to the supernatant at a ratio of 1:1 (v/v), and the mixture was stored in the dark for 25 min. To determine the amount of IAA, the absorbance at 530 nm was measured using a UV–vis double beam spectrophotometer (Thermo Scientific, GENESYS 10S UV–VIS, USA) and calibrated with a standard curve of pure IAA.

To measure the solubilization of inorganic phosphate, bacterial strain cultures were inoculated on Pikovskaya’s agar medium for 10 days at 30 ± 2 °C. Strains showing a halo zone around the colony were identified as P-solubilizing strains. For potassium solubilization, Aleksandrow agar medium was used. After incubation at 30 ± 2 °C for 7 days, the clear zone was observed. Chrome azurol S (CAS) medium was used for siderophore production according to a method described previously (Schwyn & Neilands, 1987). In brief, zinc-solubilizing bacteria were grown on NA agar at 30 ± 2 °C for 24 h and then point inoculated onto CAS agar. The cultures were incubated at 30 ± 2 °C for 5 days. A colony surrounded by light orange zones was considered to possess siderophore production ability. The production of ammonia (NH₃) was evaluated by inoculating bacterial strains into 4% peptone broth and incubating them at 30 ± 2 °C for 96 h. One milliliter of Nessler’s reagent was added after incubation. A positive result for NH₃-producing strains was the development of a yellow to dark brown hue.

Evaluation of plant growth promotion effects

Zinc-solubilizing strains were examined for their ability to stimulate the growth of green soybean (Glycine max L. Merr. cv. Kamphaeng Saen MJ101) (Tropical Vegetable Research Center, Kasetsart University Kamphaeng Saen campus) in the greenhouse of Kasetsart University on the Kamphaeng Saen campus, Nakhon Pathom, Thailand. The experiment was performed from December 2021 to February 2022. For preparation of the bacteria, each isolate was cultivated in 150 mL of nutrient broth for 24 h at 30 ± 2 °C. Then, the cells were removed by centrifugation at 8,000 rpm for 10 min. The cell pellet was washed with sterilized deionized water and then adjusted to 10⁸ cell mL⁻¹ with 0.85% normal saline.

The soybean seeds were surface-sterilized with 10% hypochlorite for 10 min and rinsed three times with sterile water (Kotabin et al., 2017). The seeds were then germinated in sterilized coco-peat for 10 days. The resulting seedlings were transplanted into 12-inch pots containing approximately 2 kg of soil and grown in a greenhouse. Sandy loam soil collected in Kamphaeng Saen district, Nakhon Pathom, Thailand, was used in the experiment. The properties of the soil were as follows: OM 16.98%, available phosphorus 1.21 g kg⁻¹, exchangeable potassium 4.73 g kg⁻¹, exchangeable zinc 12.53 mg kg⁻¹, and pH 7.65. The greenhouse was illuminated with natural light (30 °C/25 °C day/night temperatures). Each treatment was performed using 15 pots. Before the flowering stage of soybean, 5 mL bacterial suspensions (10⁸ cell mL⁻¹) were applied to each pot at 15 and 30 days after planting. Uninoculated seedlings were used as controls, and an application of 50 mg kg⁻¹ zinc sulfate was used as a positive control. Plants were cultivated until they reached the fruiting period. After 70 days of growth, the plants were harvested, and the roots were washed carefully with running water. The lengths of the shoots and roots, the shoot and root dry weights, the numbers of pods and the numbers of grains were measured. Dry weight determinations were performed at 70 °C for 2 days.

Statistical analysis

Statistical analysis was carried out by using Minitab 16 software (Minitab Inc.; Pennsylvania, USA). Data were analyzed using one-way analysis of variance followed by Tukey’s honestly significant difference test to verify significant differences between the treatments at p ≤ 0.05.

Isolation of ZSB

Zn-solubilizing bacteria (ZSB) were isolated from the rhizosphere soils of peanuts, sweet potatoes and cassava growing in Chonburi and Kanchanaburi Provinces, Thailand (Table 1). The capacity of all isolates to solubilize zinc was evaluated using agar media supplemented with insoluble Zn compounds, i.e., ZnO and ZnCO₃. The occurrence of a halo zone indicates that the isolating organism can solubilize zinc. The halo zone diameter and zinc solubilization efficiency of the selected ZSB are presented in Table 2. Out of 121 isolates, five isolates with a zinc solubilization efficiency (ZSE) greater than 2.00 on ZnO supplemented medium (KAH109, KPIB103, KPIB105, KRME106 and KEX206) and the isolate KEX505 which appears to have strong zinc solubilization on ZnCO₃ supplemented medium (ZSE 1.93) were selected for further study. All the selected strains can effectively solubilize insoluble Zn compounds, notably ZnO and ZnCO₃, under the conditions of the assay. The isolates KAH109, KPIB103, KRME106 and KEX206 showed high ZSE in both ZnO- and ZnCO₃-containing media. In comparison to that in ZnO-supplemented medium, the zone of solubilization in ZnCO₃-supplemented medium was high. ZnO-containing medium, however, was associated with a higher ZSE than ZnCO₃-supplemented medium. The isolate KAH109 exhibited the highest ZSE in ZnO-supplemented medium (2.84 ± 0.47). Therefore, 0.1% ZnO was used for the Zn solubilization study in liquid medium. The bacterial isolates solubilized insoluble ZnO at concentrations ranging from 36.12 to 62.89 mg L⁻¹ soluble Zn (Table 3). Isolate KAH109 showed the maximum solubilization of Zn (62.79 mg L⁻¹). The bacterial isolates altered the pH of the culture medium to between 5.36 and 6.40. The decrease in the pH of the culture medium was proportional to the quantity of soluble Zn produced by ZSB.

Characterization and identification

The isolates were gram-positive, rod-shaped, and endospore-producing bacteria. Based on 16S rRNA gene sequencing, the ZSB strains belonged to the phylum Firmicutes (Table 3). The isolate KAH109 showed 100% shared sequence homology with Priestia megaterium. The isolate KPIB103 showed 99.79% shared sequence homology with Bacillus mycoides. KPIB105 showed maximum shared similarity (99.79%) with Priestia megaterium. KRME106 exhibited maximum shared similarity (99.86%) with Priestia aryabhattai. The isolate KEX206 showed maximum similarity (99.79%) with Bacillus mycoides. KEX505 displayed maximum shared similarity (99.93%) with Priestia aryabhattai. The 16S rRNA gene sequences of the isolates were submitted to NCBI GenBank under accession numbers OL721893, OM011975, OL721889, OL721892, OL721880 and OL721885. On the basis of 16S rRNA gene sequences, a phylogenetic tree depicting the relationships between isolates and related bacteria was created (Fig. 1).

Plant growth-promoting traits

As shown in Table 4, the ZSB were evaluated for different plant growth promotion characteristics, including IAA production, siderophore production, NH₃ production, and phosphorus and potassium solubilization. With the exception of isolate KPIB103, all isolates produced IAA over a range of 11.36 to 33.44 mg L⁻¹. The isolate KEX505 exhibited potassium solubilization. All the isolates exhibited NH₃ production. The isolates KPIB103 and KRME106 could solubilize inorganic phosphate. None of the isolates were able to produce siderophores. Although the isolates KAH109 and KPIB105 were identified as P. megaterium, the zinc solubilization efficiency and IAA production level of the isolate KAH109 were obviously greater than those of the isolate KPIB105.

Plant growth promotion in pot experiments

According to the above results on zinc solubilization efficiency, IAA production and potassium solubilization (Table 4), Priestia megaterium KAH109 and Priestia aryabhattai KEX505 were selected to examine their capabilities of promoting plant growth in green soybean. Inoculation with Priestia megaterium KAH109 promoted the growth of green soybeans by significantly increasing the plant dry weight. P. megaterium KAH109 and P. aryabhattai KEX505 inoculation increased root length by 19.12% and 20.61%, respectively, as compared to the uninoculated control (Table 5). The plant dry weights of green soybeans inoculated with P. megaterium KAH109 and P. aryabhattai KEX505 significantly increased by 26.96% and 8.79%, respectively. Regarding production yield, inoculating P. megaterium KAH109 and P. aryabhattai KEX505 significantly increased the number of grains per plant by 48.97% and 35.29%, respectively.