ZFP36 ring finger protein like 1 significantly suppresses human coronavirus OC43 replication

Cells, virus strains and virus propagation

HCT-8 cells (ATCC, Manassas, VA, USA) were cultured in Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco BRL, Grand Island, NY, USA) and supplemented with 10% heat-inactivated fetal bovine serum (FBS), (ATCC, Manassas, VA, USA), and antibiotic-antimycotic: penicillin 100 units /ml, streptomycin 0.10 mg/ml and amphotericin B 0.25 µg/ml (Sigma-Aldrich, St. Louis, MO, USA). During virus culture, HCT-8 cells were adapted to 1% FBS. HCT-8 cells cultured with RPMI 1640 medium supplemented with 1% FBS were used to grow and subsequently titrate the OC43 human coronavirus (HCoV) stain (ATCC, Manassas, VA, USA).

Overexpression and knockdown of ZFP36L1

HCT-8 cells were stably overexpressed for ZFP36L1 (NCBI reference sequence: NM_001244701.1) with a green fluorescent protein (GFP) marker using a lentivirus vector. The ZFP36L1 gene containing both tandem zinc finger domains (TZFD) such as TZFD1 and TZFD2 were cloned in a pLV-eGFP plasmid with the help of Vector Builder Inc, IL. To make the lentivirus, pLV-eGFP plasmids containing our gene of interest were co-transfected with VSV-G and packaging plasmids encoding Gag/Pol and Rev in HEK293T cells. After 48 h, the supernatant containing the lentivirus was collected and purified by centrifugation followed by filtration. Purified lentivirus was concentrated using a sucrose gradient ultracentrifugation and this concentrated, purified lentivirus was used in the study.

Similar to ZFP36L1 overexpression, HCT-8 cells were knockdown for ZFP36L1 using ZFP36L1 specific shRNA (GTAACAAGATGCTCAACTATA). The ZFP36L1 shRNA was stably expressed using a lentivirus by cloning it in a pLV-mCherry plasmid. Lentivirus for ZFP36L1-shRNA was prepared as per the above-mentioned method by co-transfection of pLV-mCherry containing ZFP36L1 shRNA with VSV-G and packaging plasmids in HEK293T cells.

The prepared lentiviruses were used to either overexpress or knock down ZFP36L1. Successful lentivirus transduction was measured through GFP or mCherry expression for ZFP36L1 overexpression (GFP) or ZFP36L1knockdown (mCherry), respectively. Transduced HCT-8 cells were selected with an increased concentration of puromycin (2–3 µg/ml) over 7 days. Selected cells were further characterized for ZFP36L1 overexpression or knockdown using a western blot with ZFP36L1-specific antibodies.

Western blot analysis for ZFP36L1 expression

To confirm ZFP36L1 overexpression or ZFP36L1 knockdown; wild type, ZFP36L1 overexpressed and ZFP36L1 knockdown HCT-8 cells were individually seeded in T25 flasks. When cells reached 75–80% confluency, cells were lysed using a radioimmunoprecipitation assay buffer (RIPA buffer) (Cell Signaling Technology, Danvers, MA, USA) supplemented with protease-phosphatase inhibitor (Cell Signaling Technology, Danvers, MA, USA). Lysates were then centrifuged at 3,000 × g for 15 min at 4 °C. The supernatant was collected and the protein concentration in each supernatant was measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). 40 µg cell lysates were separated through 12% resolving SDS PAGE gel. After separation, proteins were transfected onto a polyvinylidene difluoride (PVDF) membrane (Thermo Fisher Scientific, Waltham, MA, USA). The PVDF membrane was blocked with 5% skimmed milk (Sigma-Aldrich, St. Louis, MO, USA) in Tris-buffered saline (TBS) for 1 h at room temperature followed by incubation with anti- ZFP36L1 antibody (1:1000) (Thermo Fisher Scientific, Waltham, MA, USA) and anti- βactin antibody (1:4000) (Cell Signaling Technology, Danvers, MA, USA) overnight at 4 °C. After overnight incubation, membranes were washed with tris-buffered saline +0.1% Tween 20 (TBST) and incubated with HRP conjugated secondary antibodies (1:2000) for 1 h at room temperature. After washing, membranes were developed using the Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, Waltham, MA, USA). Images of the western blot were taken by the Odyssey XF Imaging System (LI-COR Biosciences, Lincoln, NE). Band intensity for ZFP36L1 proteins was normalized with β-actin using ImageJ software (Schneider, Rasband & Eliceiri, 2012). A significant difference in ZFP36L1 expression in ZFP36L1 overexpressed and knockdown cells compared to wild-type cells was estimated using a paired T-test.

Determining ZFP36L1’s effect on HCT-8 cells viability

The effect of ZFP36L1 overexpression and its knockdown on cell viability was measured by trypan blue exclusion assay (Strober, 2015). Wild type, ZFP36L1 overexpressed and ZFP36L1 knockdown cells were individually seeded in 6 well plates (1.5 × 10 ⁶ cell/well) in triplicate. 96 h post-seeding, cells were washed with sterilized phosphate-buffered saline (PBS) and detached with 0.25% trypsin-EDTA (ATCC, Manassas, VA, USA). Detached cells were washed with PBS by centrifugation at 500 × g for 5 min at 4 °C, and then cells were stained with 0.4% trypan blue for 3 min and examined for cell. Changes in cell viability following ZFP36L1 overexpression or its knockdown compared to wild-type cells was estimated by paired t-test.

Measuring the effect of ZFP36L1 expression on virus titration

Wild type, ZFP36L1 overexpressed and ZFP36L1 knockdown HCT-8 cells were infected with HCoV-OC43 with 0.1 multiple of infection (MOI) individually. The supernatant from these cells was collected at 24 h, 48 h, 72 h, and 96 h p.i. Collected cell supernatants were then centrifuged at 1,000 × g at 4 °C for 15 min to remove cell debris and stored at −80 °C until used. Once samples from all time points were collected, the HCoV-OC43 virus titer was determined as per the aforementioned method (Reed & Muench, 1938). Changes in virus titer in ZFP36L1 overexpressed or ZFP36L1 knockdown cells were compared to wild-type cells and statistically analyzed by a paired T-test.

Measuring the effect of ZFP36L1 expression on HCoV-OC43 replication

To measure the effect of ZFP36L1 overexpression or ZFP36L1 knockdown on HCoV-OC43 replication, we infected ZFP36L1 overexpressed, ZFP36L1 knockdown or wild type HCT-8 cells with HCoV-OC43 (MOI: 0.1). Infected cells were collected at 72 and 96 h p.i. Viral RNA was isolated from infected cells using the QIAamp Viral RNA Mini kit (Qiagen, Valencia, CA, USA). The viral nucleocapsid was quantified using qPCR (Stratagene MX3000P Real-Time Thermocycler; Stratagene Inc., La Jolla, CA, USA) in 25 µl reaction using syber green dye. Primer sequence for nucleocapsid (F: 5′-: GCTGTT TWTGTTAAG TCYAAA GT-3′, R: 5′- ATTCTGATAGAGAGTGCYTAT Y-3′) were used (Al-Khannaq et al., 2016) with qPCR amplification cycle at 95 °C/2 min, 40 cycles of (95 °C/15 and 60 °C/1 min) followed by melting curve cycle at: 95 °C/ 15 s, 60 °C/1 min and 95 °C/15 s. Fold change in HCoV nucleocapsid expression in each cell was estimated by paired -test.

Statistical analysis

The significant change in HCoV-OC43 titer and virus replication in wild-type, ZFP36L1 overexpressed, or ZFP36L1 knockdown cells was estimated using a paired T-test with 95% degree of freedom. Virus titer in wild-type, ZFP36L1 overexpression or ZFP36L1 knockdown cells was repeated at least three times with calculations for average, standard deviation, and standard error.

ZFP36L1 was overexpressed or knockdown in HCT-8 cells

A stable ZFP36L1 overexpression with an upstream GFP marker in HCT-8 cells was generated using a lentivirus system. GFP expression in HCT-8 cells was considered positive for ZFP36L1 overexpression (Fig. 1B), which was further confirmed by western blot (Figs. 2 and 3). Similarly, ZFP36L1 was knockdown using ZFP36L1-specific shRNA. The shRNA was located downstream to mCherry and expression of ZFP36L1-specific shRNA was determined by mCherry expression (Fig. 1C) and ZFP36L1 knockdown was confirmed by western blot analysis (Figs. 2 and 3). Our results showed that lentivirus significantly overexpressed or knockdown ZFP36L1 in HCT-8 cells (p < 0.05) (Figs. 2 and 3).

ZFP36L1 overexpressing or its knockdown did not affect HCT-8 cells’ viability

The effect of ZFP36L1 overexpression or its knockdown was measured on HCT-8 cells’ viability using trypan blue exclusion assay. The results showed that overexpression or knockdown of ZFP36L1 in HCT-8 cells did not affect its viability. Wild type, ZFP36L1 overexpressed and ZFP36L1 knockdown cells showed viability as 94.83 ± 1.01%, 94.16 ± 0.71%, and 95.83 ± 0.43% at 96 h post seeding, respectively These values were non-significant different to each other (p < 0.05) (Fig. 4). Additionally, no apparent morphological changes were observed among these cells.

ZFP36L1 overexpression significantly suppressed, while ZFP36L1 knockdown significantly enhanced the HCoV-OC43 production

Wild type, ZFP36L1 overexpressed, and ZFP36L1 knockdown HCT-8 cells were infected individually with HCoV-OC43 with a MOI of 0.1. Cell supernatants were collected at 24 h, 48 h, 72 h, and 96 h p.i. and analyzed for virus titer.

The results showed that ZFP36L1 overexpression in HCT-8 cells significantly reduced virus titer (p < 0.05) (Fig. 5). Virus titer in ZFP36L1 overexpressed cells ion was 2.24 ± 1.28 log 10/ml and 4.32 ± 0.00 log 10/ml at 72 h and 96 h p.i. respectively. These titer values were significantly lower than virus titers in wild-type cells at same time points, such as 72 h p.i. (4.08 ±  0.11 log 10/ml) and 96 h p.i. (5.42 ± 0.10 log 10/ml) (p < 0.05) (Fig. 5).

Results with ZFP36L1 knockdown HCT-8 cells showed that ZFP36L1 knockdown significantly enhanced virus titer (p < 0.05) (Fig. 5). Knocking down ZFP36L1 facilitated the infectious virus production as early as 48 h p.i. while wild-type cells produced infectious viruses at 72 h p.i. The virus titer in ZFP36L1 knockdown cells was recorded as 00.00 ± 0.00 log 10/ml, 2.86 ± 0.00 log 10/ml, 4.52 ± 0.22 log 10/ml, and 5.85 ± 0.01 log 10/ml at 24 h, 48 h, 72 h and 96 h p.i., respectively. While wild-type HCT-8 cells have virus titer of 0.00 ± 0.00 log 10/ml, 0.00 ±0.00 log 10/ml, 4.08 ± 0.11 log 10/ml, and 5.42 ± 0.10 log 10/ml at 24 h, 48 h, 72 h and 96 h p.i., respectively. Virus titer in ZFP36L1 knockdown cells was significantly higher at 48 h and 96 h p.i compared to wild-type cells (p < 0.05) (Fig. 5). Results also showed a lower cytopathic effect in ZFP36L1 overexpressed or wild-type HCT-8 cells compared to ZFP36L1 knockdown cells at 72 h p.i. (Fig. 6)

ZFP36L1 overexpression significantly suppressed while ZFP36L1 knockdown significantly enhanced the HCoV-OC43 RNA replication

To further confirm ZFP36L1’s effect on HCoV-OC43 RNA replication, wild type, ZFP36L1 overexpressed and ZFP36L1 knockdown HCT-8 cells were individually infected with HCoV-OC43 (MOI: 0.1). Infected cells were collected at 72 and 96 h p.i. Viral RNA was isolated from infected cells and viral nucleocapsid transcription (RNA concentration) was analyzed using qPCR. Results showed a significant increase in HCoV-OC43 nucleocapsid expression at 72 h and 96 h p.i. in ZFP36L1 knockdown HCT-8 cells while ZFP36L1 overexpression significantly suppressed HCoV-OC43 nucleocapsid expression at both of these time points (e.g., 72 and 96 h p.i.) (p < 0.05). ZFP36L1 knockdown HCT-8 cells displayed a 3.56 ± 0.77 and 7.67 ± 1.69-fold increase in HCoV-OC43 nucleocapsid expression as compared to wild-type HCT-8 cells at 72 h and 96 h p.i., respectively (Fig. 7). ZFP36L1 overexpressed cells displayed a significantly lower HCoV-OC43 nucleocapsid expression such as 0.38 ± 0.16 and 0.16 ± 0.03 fold compared to wild-type cells at 96 h p.i. (p < 0.05) (Fig. 7).