Histone H3K9 demethylase JMJD2B/KDM4B promotes osteogenic differentiation of bone marrow-derived mesenchymal stem cells by regulating H3K9me2 on RUNX2

Cell culture

Human bone marrow-derived mesenchymal stem cell line was obtained from Saliai Biotechnology (G02007; Saliai Biotechnology, Guangzhou, China). Cells were maintained in α-MEM (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS), 50 µM ascorbate, 1% penicillin-streptomycin, and 10 mM β-glycerophosphate in a humidified atmosphere with 5% CO₂ at 37 °C. Cells at the third or fourth passage were used in the experiments. For osteogenesis treatment, cells were cultured in human bone marrow mesenchymal stem cells osteogenic medium (HUXMA-90021; Cyagen).

Plasmid construction and recombinant lentivirus packaging

Human JMJD2B was amplified using primers 5′- gcatgcATGGGGTCTGAGGACCACG -3′ (sense) and 5′- atgcatTCATCTGCAAGGGTCTTGAGTTG -3′ (antisense) and cloned into LV5-GFP/Puro vector (Clontech, Mountain View, CA, USA). The clones were confirmed by DNA sequencing. Add the shuttle plasmid and packaging plasmid (LV5-JMJD2B, pRev, pVSV-G) containing the target sequence to 293T cells in proportion. The hJMJD2B shRNA was designed according to the shRNA design rules and other literature (Ye et al., 2012). Bbs I; and BamH I; restriction sites were added to the shRNA end. The designed shRNA sequence was created by Jimma Gene(Shanghai,China).sh-hJMJD2B F: 5′-CACCGCCTGCCTCTAGGTTCATAATTCAAGAGATTATGAACCTAGAGGCAGG TTTTTTG-3′; Sh-hJMJD2B R: 5′-GATCCAAAAAACCTGCCTCTAGGTTCATAATCT CTTGAATTATGAACCTAGAGGCAGGC-3′. hJMJD2B shRNA was amplified and cloned into pGPU6/GFP/Neo vector (Clontech, Mountain View, CA, USA). The clones were confirmed by DNA sequencing. Add the lentiviral vector (Double-stranded GPR78 shRNA) containing the target sequence to 293T cells in proportion.

Transfection

Overexpression and silencing recombinant lentiviruses were purchased from Shanghai Hanheng Biotechnology. Collect hBMSCs cells in logarithmic growth phase, count, resuspend cells in complete medium, adjust the cell concentration to 1 ×10⁵ cells/ml, inoculate into six-well plates, add 2ml of cell suspension to each well, and store at 37 °C, 5% CO₂ conditions Incubate overnight. Incubate overnight until the cell density is about 40% to 60%, and carry out virus infection by 1/2 small volume infection method. Aspirate the original medium in the culture well, add 1/2 volume (1 ml) of α-MEM low-glucose medium, and add polybrene to a final concentration of 5 µg/ml, add the corresponding volume of virus stock solution at MOI = 50, shake well, and put Incubate for 4 h at 37 °C, 5% CO₂. After 4 h of incubation, add 1/2 volume (1 ml) of α-MEM low-glucose medium to the culture wells, and incubate overnight at 37 °C under 5% CO₂ conditions. On the second day after infection, the virus-containing medium was aspirated, replaced with fresh α-MEM low-glucose medium (without polybrene), and the culture was continued at 37 °C, 5% CO₂. After hBMSCs were infected with virus for 72 h, the cells were digested and collected, and the cellular protein and RNA were extracted. The expression of JMJD2B in hBMSCs cells was detected by WB and qPCR. The method is the same as before.

Alkaline phosphatase staining

Data were collected as previously described in Wu et al. (2021). Specifically, Alkaline phosphatase staining was performed using a BCIP/NBT Alkaline Phosphatase Color Development Kit (C3206; Beyotime, China) following the manufacturer’s manual. hBMSCs cells were cultured in osteogenic medium for 1, 3, 7 or 14 days, washed with ice-cold PBS, and fixed with 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) for 15 min. Add BCIP solution (300X), NBT solution (150X), and BCIP/NBT dyeing working solution in sequence according to the following proportions. Add the BCIP/NBT dyeing working solution obtained after mixing to ensure that the sample can be fully covered. Incubate in the dark at room temperature for 5–30 min or longer (up to 24 h) until the color develops to the expected depth. The ALP positive cells stained blue/purple. For each experiment, a minimum of three washes was counted and the experiments were repeated three times. ALP staining was observed using a 450-fluorescent inverted phase-contrast microscope (Olympus, Tokyo, Japan)

Alizarin red staining

Data were collected as previously described in (Wu et al., 2021). Specifically, cells were cultured in osteogenic medium for 1, 3, 7 or 14 days and then fixed in 95% ice-cold ethanol for 15 min. After three washes with ice-cold PBS, cells were stained with alizarin red (Sigma-Aldrich) for 5 min. Alizarin red staining was observed using an Olympus 450-fluorescent inverted phase-contrast microscope (Olympus, Tokyo, Japan).

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated from hBMSCs cells using Trizol reagent (DP424, Tiangen, Beijing, China). All quantitative real-time PCR assays were carried out using three technical replicates and three independent cDNA syntheses. Reverse transcription reaction using cDNA synthesis kit (KR118; Tiangen, Beijing , China), qRT-PCR was performed using a fluorescence quantitative PCR kit (QP002, Fulengen, Guangzhou, China) and gene-specific primers (Table 1). GAPDH was used as an internal reference. The relative gene expression was determined using the 2^−ΔΔCt method. The PCR reactions were performed in triplicates.

Western blot analysis

Data were collected as previously described in (Wu et al., 2021). Specifically, proteins were isolated from hBMSCs cells using RIPA buffer. Protein samples were separated using 5% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was incubated with primary antibody against target protein (Table 2), and β-actin (1:2000; B1033; Biodragon) Incubated overnight at 4 °C. The membrane was washed three times with TBST and incubated with HRP-linked secondary antibody (1:1,000; 7074P2; Cell Signaling Technology) for 1 h at room temperature.

Chromatin immunoprecipitation (ChIP)

Treatment of cells with ultrasound cross-linking. ChIP was performed using a ChIP Assay Kit (22202-20; Beyotime, China) following the manufacturer’s instruction. Briefly, cell lysates were centrifuged at 12,000 rpm for 5 min at 4 °C. Take out 20 µl sample as Input for subsequent testing. Add 70 µl protein A+G Agarose/Salmon Sperm DNA to the remaining nearly 2 ml sample (about 35 µl is precipitation and 35 µl is liquid), and mix slowly or shake at 4 °C for 30 min. The supernatant was collected, and incubated with 0.5–1 µg anti-H3K9me2 (6814-25; Biovision) and protein A+G Agarose/Salmon Sperm DNA (of which about 30 µl is precipitation and 30 µl is liquid) overnight at 4 °C. The immunoprecipitates were collected and washed three times with wash buffer. Next, the DNA fragments are purified for subsequent PCR experiments. Wash the sample three times with Elution buffer. Add 20 µl of 5M NaCl to 500 µl of supernatant, mix well, and heat at 65 °C for 4 h to remove crosslinks between protein and genomic DNA. For the 20 µl sample obtained as Input, add 1 µl 5M NaCl, mix well, and heat at 65 °C for 4 h. Then add an appropriate amount of EDTA, proteinase K, Tris, chloroform, glycogen, NaAc, and absolute ethanol for further purification, and the obtained DNA precipitate is used for PCR detection of the target gene.

Immunofluorescence staining

hBMSCS cells were seeded in a 6-well plate at a density of 1 ×10⁵ cells/well. Cells were washed three times with PBS. After treatment, Cells were fixed in 4% paraformaldehyde solution for 15 min at room temperature,followed by fixation with pre-cooled acetone for 15 min. Later, they were washed twice in PBS followed by a 30-minute incubation in 2% bovine serum albuminsolution (Sigma-Aldrich, Cat# A7906-50G). Cells were then treated with 0.5% PBS-Triton X-100 for 20 min and incubated with 3% H₂O₂ for 15 min. The samples were then blocked with 5% serum for 20 min and incubated with JDJM2B (1:1000; Ab191434; Abcam) and FAM210A(1:200; NBP2-13992; Novusbio) overnight at 4 °C. Then add 200 µL of APC-labeled secondary antibody (1:500) to the sample, and incubate for 1 h at 37 °C, 5% CO₂, and saturated humidity. The nucleus was stained with DAPI (S2110; Solarbio) for 1 min. Finally, the samples were washed to remove excess solution and mounted on microscope slides for imaging Images were collected using VistarImage 3.0 software (Nikon, Japan) software connected to a Olympus CKX53 inverted microscope. Images were acquired using an UPlanFLN objective at magnification 40 ×.

Statistical analysis

Data are expressed as the mean ±standard deviation. Statistical analysis was performed using SPSS 23.0 software (SPSS Inc., Chicago, IL, USA). Comparisons among different groups were performed using one-way analysis of variance followed by Tukey’s post hoc test. A P value less than 0.05 was considered statistically significant.

Osteogenesis promotes JMJD2B expression in hBMSCs cells

To investigate the effect of osteogenic medium on hBMSCs proliferation, we treated hBMSCs cells at different time points. To further examine the effect of osteogenic medium treatment on osteogenesis and the involvement of histone modification, we determined the mRNA levels of JMJD2B as well as osteogenesis- and myogenesis- genes in hBMSCs cells at 0, 1, 3, 7, 14 days. The results showed that the osteogenic medium significantly upregulated the mRNA expression of Runx2 during the initial (day 3) osteogenic induction process, and furthermore dramatically upregulated the mRNA expression of FAM210A and JMJD2B at 7 and 14 days simultaneously (Fig. 1A).

To further investigate whether osteogenesis affects related protein level. We determined the related protein level in hBMSCs cells treated with osteogenic medium. As shown in Fig. 1A, compared with cells at day 0, the proper osteoinduction time markedly elevated the protein levels of total Runx2, JMJD2B and FAM210A but slightly inhibited Runx2 at day 1, suggesting that osteogenesis may be induced by JMJD2B-mediated histone modification and the expression of FAM210A and Runx2. Next, we detected structure of histone demethylase regulating epigenetic modification in hBMSCs cells to investigated whether JMJD2B-mediated histone demethylation affects hBMSCs differentiation. JMJD2B immunofluorescent staining showed that osteogenesis substantially promoted JMJD2B level at 7, 14 days compared with the control (day 0), whereas no obvious changes in fluorescence signal were shown in 1 day and 3 days. Of note, osteogenesis also significantly promoted FAM210A level (Fig. 1C), which plays a vital role in regulating the structure and function of bones and muscles. These data suggest that osteogenesis may be induced by regulating JMJD2B-mediated histone modification and Runx2 and FAM210A-mediated differentiation of hBMSCs.

Histone H3K9 Demethylase JMJD2B promotes osteogenic differentiation of hBMSCs

To examine whether overexpression of JMJD2B could reverse the effect of silence JMJD2B lentivirus-transfected hBMSCs on osteogenesis, we overexpressed/silenced JMJD2B in hBMSCs cells and then treated the cells with vehicle or osteogenesis Induction Medium. As shown in Figs. 2A and 2B, qRT-PCR and western blot revealed that in general, overexpression of JMJD2B remarkably enhanced mRNA expression and protein level of JMJD2B, while silence of JMJD2B attenuating mRNA/protein expression of JMJD2B (Figs. 2A–2B), regardless of the status of initial protein level. Compared with empty vector transfection (Scr and NC), overexpression of JMJD2B enhanced the intensities of ALP and alizarin red staining, in the presence of osteogenic medium, significantly in 7, 14 days. Silence of JMJD2B treatment resulted in reductions in ALP and alizarin red staining in empty vector-transfected cells. Importantly, slience of JMJD2B reduced ALP and alizarin red staining in the presence of osteogenic medium, suggesting that slience of JMJD2B abrogates the facilitate effects of osteogenic medium on osteogenic differentiation and mineralization of hBMSCs. According to the outcome of staining experiments based on the overexpression of JMJD2B in hBMSCs, that are contrary to silence effect further verify the key role of JMJD2B in the induction of osteogenic differentiation.

Then, we measured the mRNA levels of osteogenic markers in hBMSCS cells in response to JMJD2B overexpression/slience. As shown in Fig. 2C, compared with Scr/NC, JMJD2B overexpression dramatically promoted mRNA expression of osteogenic markers, including Runx2, Ocn, Opn, and Osx, whereas JMJD2B slience generally showed counter effects on mRNA expression of these genes (Fig. 1C, upper and middle panels), regardless of the presence of osteogenic medium. Collectively, the combined results of Figs. 1 and 2 suggest that histone H3K9 Demethylase JMJD2B might promotes osteogenic differentiation of hBMSCs by regulating the expression of Runx2,Ocn,Opn,Osx.

JMJD2B regulates the methylation enrichment status of H3K9me2 in RUNX2 promoter to influence the osteogenic differentiation of hBMSCs

Considering the critical role of JMJD2B in osteogenesis and the essential role of histone modification in hBMSCs differentiation regulation, we examined the effect of JMJD2B overexpression/slience on the methylation enrichment status of H3K9me2 in the Runx2 promoter in hBMSCs exposed to osteogenic medium, we wanted to determine whether the altered transcriptional activity of JMJD2B may be attributed to differences in DNA binding. To do this we compared the chromatin association of H3K9me2 with the Runx2 promoter using Chromatin Immunoprecipitation (ChIP). LV5-JMJD2B significantly increased H3K9me2 occupancy at the Runx2 promoter. However, Si-JMJD2B decreased H3K9me2 recruitment to Runx2 promoter (Fig. 3A). These results strongly suggest that LV5-JMJD2B has a different activity of co-regulator recruitment than Si-JMJD2B. The ChIP results revealed that binding levels of H3K9me2 at the promoter regions of Runx2 were significantly increased when JMJD2B overexpressed, whereas they were reduced at the promoter region while slienced (Fig. 3A), regardless of the presence of osteogenic medium.

As shown in Fig. 3B, compared with control, H3K9me2 inhibitor BIX01294 impaired the intensities of ALP and alizarin red staining, in the presence of osteogenic medium. Osteogenic medium treatment resulted in enhancement in ALP and alizarin red staining in control cells. Importantly, inhibition of H3K9me2 reduced ALP and alizarin red staining in the presence of osteogenic medium, suggesting that inhibition of H3K9me2 abrogates the promotion effects of osteogenic medium on osteogenic differentiation and mineralization of hBMSCs.

To further investigate whether JMJD2B activates H3K9me2 binding levels, we measured the mRNA levels of Runx2 and JMJD2B in hBMSCs cells in response to H3K9me2 inhibition. As shown in Fig. 3C, compared with control, H3K9me2 inhibition dramatically reduced mRNA expression of Runx2 and JMJD2B. Next, we determined the protein level in hBMSCs cells inhibiting H3K9me2. As shown in Fig. 3D, compared with control, inhibition of H3K9me2 markedly cut down the protein levels of Runx2 and H3K9me2 but showed no significantly effects on JMJD2B in the presence of osteogenic medium. To examine whether compensatory expression of JMJD2B could reverse the effect of BIX01294 on these proteins, we overexpressed JMJD2B in hBMSCs and then treated the cells with DMSO medium dilution solution or BIX01294. Treatment with LV5-JMJD2B significantly overexpressed JMJD2B and elevated protein levels of Runx2 and JMJD2B in the absence or presence of BIX01294. Of note, inhibition of H3K9me2 significantly reduced Runx2 and H3K9me2 protein levels but does not affect the compensatory increase of JMJD2B overexpressing JMJD2B (Fig. 3E). qRT-PCR revealed that in general, overexpression of JMJD2B remarkably enhanced mRNA expression of Runx2 and JMJD2B.This enhancement slightly hindered by BIX01294 (Fig. 3F). These results suggest that by affecting the methylation enrichment status of H3K9me2 in the Runx2 promoter, JMJD2B may regulate the expression of Runx2 and mediate the differentiation of hBMSCs.