HIF1α is dispensable for oocyte development and female fertility in mice

Mice

Animal care and use were carried out in accordance with the guiding principles of the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University (Approval No. IACUC-1806013). Mice housed in 12–12 h light-dark cycle, with constant temperature and with food and water provided ad libitum under SPF (specified pathogen free) conditions. Mice were randomly divided into cages, and each cage was capable of housing 4–5 mice. All cages were maintained in similar conditions, including cages density, bedding, and sanitation frequency. Mice were anesthetized with carbon dioxide for oocyte collection. No animals survived at the end of study.

Mice possessing loxP sites flanking exon 2 of the Hif1α gene were kindly provided by Dr. Jin Hou at Second Military Medical University (Liu et al., 2019). Gdf9-Cre transgenic mice were a gift from Dr. Heng-Yu Fan (Yu et al., 2013). To generate Hif1α^fl/fl; Gdf9-Cre mice (referred to as Hif1α-cKO), female mice carrying the Hif1α floxed alleles were mated with Gdf9-Cre males (Yu et al., 2013). The Hif1 α^fl/fl female mice were used as the control group (referred to as Control). Genotyping for LoxP and Cre were carried out using PCR amplification. Primers for Hif1α Loxp (Forward: 5′—AGTTACAGGTATTTATGAGCCA—3′, Reverse: 5′—CTAGTTGATCTTTCCGAGGAC—3′), and Gdf9-Cre (Forward: 5′—GGCATGCTTGAGGTCTGATTAC—3′, Reverse: 5′—CAGGTTTTGGTGCACAGTCA—3′) were used at 10 pmol using Vazyme PCR mix following manufacture’s protocol.

Fertility test

To perform fertility test, seven pairs of 8 weeks Control and Hif1α-cKO female mice were randomly selected and continually bred with WT male mice which have been confirmed fertility for 6 months. The mice were checked every week and the date and number of pups and litter size was recorded for each litter.

Oocyte collection and in vitro maturation

To collect GV oocytes, 6-8 weeks of females (n = 5) were stimulated with 5 IU PMSG (pregnant mare serum gonadotropin) (Ningbo, No. 2 hormone factory, Zhejiang, China). After 44–48 h, GV oocytes were carefully isolated from antral ovarian follicles by manual rupturing of antral ovarian follicles. For in vitro maturation, Oocytes were cultured in M2 media under mineral oil at 37 °C in a 5% of CO₂ incubator.

To obtain MII oocytes, mice (n = 5) were induced to superovulate by IP injection of 5 IU PMSG followed 48 h later by injection of 5 IU hCG (Human Chorionic Gonadotropin). 16 h after hCG injection, mice were sacrificed and the oviducal ampullae were broken to release the cumulus-oocyte complexes. MII oocytes were freed of cumulus cells by exposure to 0.2% hyaluronidase.

In vitro fertilization and embryo culture

IVF assays were conducted as we described previously (Han et al., 2018). Briefly, normal sperm were isolated from the dissected epididymis of C57BL/6 male mice aged 10–20 weeks and left to capacitate for 1 h in HTF fertilization medium (Millipore, Merck) supplemented with 10 mg/ml BSA (bull serum albumin). Cumulus–oocyte complexes (COCs) were isolated from oviduct ampullae, and placed in other HTF fertilization medium (Millipore, Merck) supplemented with 10 mg/ml BSA. Then, dispersed spermatozoa were added to HTF drops containing COCs for fertilization in a 37 °C incubator. After co-incubation for 6∼9 h, presumptive zygotes were washed to remove cumulus cells and excess sperm, and then transferred into KSOM medium (Merck Millipore, Burlington, MA, USA) for further culture. Early embryo development potential was assessed at the indicated time points during culture.

Western blot

Samples each containing 100 MII oocytes from 5 mice were collected in SDS sample buffer and heated for 5 min at 100 °C. The proteins were separated by 10% SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membrane (Millipore, Darmstadt, Germany) by electrophoresis. After transfer, the membranes were blocked in PBST buffer containing 5% skimmed milk for 1 h, followed by incubation overnight at 4 °C with 1:2,000 anti-HIF1α antibody (ab237544; Abcam, UK) and 1:1,000 anti-α-Tubulin antibody (ab7291; Abcam, UK). After multiple washes, the membranes were incubated with horseradish peroxidase conjugated antibody for 1 h at room temperature. Finally, the bands were visualized using an ECL Plus Western Blotting Detection System (GE Healthcare, Little Chalfont, UK).

Immunofluorescence

MII oocytes from mice were fixed in 4% paraformaldehyde in PBS for 30 min at room temperature, and permeabilized with 0.5% Triton X-100 for 20 min. Following incubation in 1% BSA blocking buffer for 1 h at room temperature, oocytes were incubated with FITC-conjugated anti-Tubulin antibody (F2168; Sigma-Aldrich) at 4 °C overnight. After rinsing with PBS, the oocytes were stained with propidium iodide (PI; 10 µM in PBS). Then the oocytes were mounted on glass slides and examined with a confocal laser scanning microscope (LSM 710; Carl Zeiss, Jena, Germany).

RNA extraction and Real-time quantitative PCR

Total RNA was extracted from 50 oocytes using the Arcturus PicoPure RNA Isolation Kit (Applied Biosystems, CA, USA). Then RNA from each group was reverse transcribed into cDNA using a QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. qRT-PCR was conducted using AceQ qPCR SYBR Green Master Mix (High ROX Premixed) (Vazyme) with Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Massachusetts, USA). Data were normalized against Gapdh and quantification of the fold change was determined by the comparative CT method, as previously described (Li et al., 2020). The related primers are listed below: Hif1α F: 5′-GCACCGATTCGCCATGGAG-3′, R: 5′-TCTAGACCACCGGCATCCAG-3′; Hif1α F: 5′-TCCTTCGGACACATAAGCTCC-3′, R: 5′-GACAGAAAGATCATGTCACCGT-3′; Hif1α F: 5′-GAAGTTCACATACTGCGACGA-3′, R: 5′-GTCCAAAGCGTGGATGTATTCAT-3′; Gapdh: 5′-AGGTCGGTGTGAACGGATTTG-3′, R: 5′-TGTAGACCATGTAGTTGAGG TCA-3′.

Statistical analysis

All experiments were repeated at least three times. GraphPad Prism 7 software (GraphPad Software, San Diego, CA, USA) was used to analyze data and draw graphs. Student’s t test was used for statistic comparison. Data were reported as mean  ± SD, and p < 0.05 were considered statistically significant. n.s., not significant.

Generation of mutant mice with oocyte-specific deletion of Hif1α

So far, three different alpha subunits have been known to exist in higher metazoans, termed HIF1α, HIF2α and HIF3α (Webb, Coleman & Pugh, 2009). By performing quantitative real-time PCR, we showed that Hif1α was predominantly expressed in oocytes (Fig. 1A). This observation suggests that HIF1α may have an important role in oocyte development. To investigate this, we generated mutant mice in which exon 2 of the Hif1α gene was targeted (Fig. 1B). This was achieved by crossing Hif1α^fl/fl mice with transgenic mice expressing Gdf9 promoter-mediated Cre recombinase, which mediates recombination in mouse oocytes at the primordial stage, to knock out Hif1α specifically in oocytes (Yu et al., 2013). Hereafter, Hif1α^fl/fl; Gdf9-Cre and Hif1α^fl/fl mice are referred to as Hif1α-cKO and Control mice, respectively. Mice homozygous for this floxed allele and positive for Gdf9-Cre transgene were validated by genotyping PCR (Fig. 1C). qRT-PCR confirmed that oocytes from Hif1α-cKO mice had undetectable Hif1α mRNA as compared to those from Control mice (Fig. 1D). Moreover, immunoblotting result showed the absence of HIF1α protein in Hif1α-cKO oocytes (Fig. 1E), suggesting that Gdf9- mediated Cre excision of Hif1α is sufficient to delete HIF1α protein in mouse oocytes.

HIF1α was dispensable for female fertility

To detect the effect of HIF1α deletion on female fertility, breeding assay was carried out by mating Hif1α-cKO or Control mice with males of proven fertility for 6 months. As shown in Fig. 2A, female Hif1α-cKO mice were fertile and gave birth to pups comparable to that of Control mice. To assess oocyte quality, we superovulated Control and Hif1α-cKO females and collected oocytes at 16 h post-hCG injection. The oocytes collected from Hif1α-cKO ovaries were morphologically normal, displaying intact first polar body (Fig. 2B). In addition, there was no difference between the number of ovulated eggs from the Control and Hif1α-cKO ovaries (Fig. 2C). We then asked whether HIF1α deletion in oocytes would adversely affect the developmental competences of subsequent embryos. To do this, we carried out in vitro fertilization (IVF) of oocytes derived from Control and Hif1α-cKO mice, and cultured fertilized embryos in vitro to monitor early embryo development (Fig. 2D). Zygotic embryos from Hif1α-cKO oocytes exhibited similar on-time progression to 2-cell, 4-cell and blastocyst stages relative to Controls (Figs. 2E, 2F). These results show that loss of HIF1α in oocytes does not affect the fertility of female mice.

HIF1α deletion exerts little effect on oocyte maturation and spindle organization in vitro

Given that HIF1α is not essential for oocyte maturation in vivo, we next studied how Hif1α-cKO oocytes matured in vitro. Fully-grown oocytes harvested from hormonally stimulated Control and Hif1α-cKO mice were cultured in maturation media to assess meiotic resumption within 3 h, and PB1 extrusion within 16 h (Fig. 3A). Comparable numbers of fully-grown germinal vesicle-stage (GV) oocytes were obtained from Control and Hif1 α-cKO mice ovaries (Figs. 3B, 3C), suggesting that the ovarian reserve is not compromised in the absence of HIF1α. Then, the collected GV oocytes were released for maturation in vitro. Meiotic resumption, as indicated by GV breakdown (GVBD), occurred in 80% of Hif1α-cKO oocytes during the first 2 hours’ culture, similar to the rate observed in Control oocytes (Fig. 3D). Next, we analyzed the exit from MI, marked by first polar body extrusion (PBE). We found that PBE began around 8–10 h for both Control and Hif1α-cKO oocytes and that both attained maximal PB1 rates of around 95% by 14 h (Fig. 3E). In addition, we examined spindle organization and chromosome alignment in Control and Hif1α-cKO oocytes that had extruded PB1. Immunofluorescence results showed that barrel-shape spindle and well-aligned chromosomes were readily observed in Hif1α-cKO oocytes, and that errors in meiotic apparatus were not markedly increased (Figs. 3F, 3G). Thus, loss of HIF1α does not compromise oocyte maturation and spindle organization in vitro.

Loss of HIF1α did not disrupt the expression pattern of other HIF isoforms in oocytes

HIFα subunits exist as a series of isoforms encoded by distinct genetic loci. Among three HIFα isoforms, HIF1α and HIF2α appear closely related and can interact with hypoxia response elements (HREs) to activate transcription (Wiesener et al., 1998). We speculated that other subunits might compensate for the role of HIF1α in oocytes. However, the mRNA expression levels of Hif2α and Hif3α were not significantly changed in HIF1α-deleted oocytes (Fig. 4). This finding indicates that the null of HIF1α did not induce the compensatory expression of other isoforms, and demonstrates that HIF pathway is not required for oocyte development.