Characterizations of novel pesticide-degrading bacterial strains from industrial wastes found in the industrial cities of Pakistan and their biodegradation potential

Contribution

Our study’s uniqueness was to collect samples specifically from the unexplored points of pesticide wastes to isolate the possible native bacterial strains. We also observed the extent of bacterial chemical utilization capacity, especially for DDT, aldrin and malathion. The study gives an insight into the soil that was chemically polluted with these pesticides and could be restored for further cultivation purposes. After confirming their presence, further chemical tests and morphological studies were conducted to improve our understanding of these bacterial strains that can further be utilized to treat chemically polluted land and water.

Sampling and management

Samples were obtained from effluents of five industrial sites, mainly located at Faisalabad and Lahore in Pakistan. Water and soil samples were randomly collected from industrial drainage sources and garbage/disposal points, respectively, where the possibility of the presence of effluents was higher. The soil and water samples were collected with the consent of the landowner. No animal or plant species were harmed during the collection process. Standard procedures were used to obtain sludge samples (Ghanem, Orfi & Shamma, 2007), from wastewater near industrial area carrying effluents from the pesticide manufacturing plants (Farhan et al., 2012). All the reagents and chemicals were analytical grade purchased from Merck, Germany, and Sigma-Aldrich USA. The pesticides (malathion, DDT and aldrin) with >99% purity were obtained from Sigma-Aldrich, USA. Synthetic oligonucleotides were provided by the Integrated DNA Technologies (IDT), USA for this study. Physical samples of microbial isolates used in this study were permanently deposited at National Institute of Biotechnology and Genetic Engineering (NIBGE) Faisalabad, Pakistan

Sample processing and enrichment

To maintain the biological activity of the soil microflora, the samples were obtained from contaminated areas in sterile polythene bags kept at 4 °C. On the day of collection, the soil samples were further treated by mixing 10 g of soil sample in a 100 mL of autoclaved water. The mixture was then kept at room temperature (30 °C) in an orbital shaker for 24 h at 100 rpm. The enrichment culture method was acquired to isolate pesticide biodegrading bacterial strains. To improve the likelihood of detecting pesticide-degrading native microflora, samples were first supplemented with commercial-grade pesticides (Khan et al., 2016). From each water and soil sample, 10 mL were inoculated into 100 mL of fresh MSM broth in 250 mL Erlenmeyer flasks containing 20 mg/mL selected pesticides as the sole source of carbon and phosphorus. The flasks were incubated for seven days at 150 rpm under ambient conditions. The cultures were gradually acclimated to increase the three applied pesticides ranging from 20–50 mg/mL at weekly intervals. At about a final concentration of 50 mg/mL of different pesticides, the pesticide tolerant cultures were subjected to further degradation study. Media without inoculation was run as a control. The experiments were performed in triplicate for authentication (Jiang et al., 2019).

Isolation of biodegrading strains

For the isolation of pesticide degrading bacteria, the nutrient agar media plates were first inoculated with one mL of each enriched culture and then incubated at 37 °C till colonies appeared. Lone colonies were picked and streaked aseptically on solid media plates followed by incubation at 37 °C for 48 h. Separate colonies were sub-cultured onto nutrient agar plates till pure cultures were obtained. The strains from pure culture were then inoculated into 100 mL MSM broth which contained 50 mg/mL of selected pesticides added as the sole source of carbon or phosphorus, or both carbon and phosphorus sources to determine their degradation ability at different time intervals (2, 6, 8, 12, 16, 20, 24, 30, and 36 h) at 30 °C. Negative controls were always run to ensure that mentioned sources in the media were not contaminated. The measurement of the absorbance was done by using an Agilent Cary 5000 Ultraviolet-to-Visible to-Near-Infrared (UV-Vis-NIR) spectrophotometer (Agilent Technologies, Petaling Jaya, Malaysia) (Roy et al., 2018). The cultures with the highest degradation ability were stored in glycerol as nutrient-agar slants at 4 °C.

${\displaystyle \text{Degradation Rate}\text{\%}=\frac{\text{Initial OD}-\text{Final OD}}{\text{Initial OD}}\times 100}$

Identification and characterization of isolates

The identification and characterization of biodegrading isolates were carried out using morphological, biochemical, and molecular tests. The preserved isolates showing maximum degradation activity were picked and grown on the nutrient medium through spread plate method followed by culturing at 37 °C for 48 h as described by Jiang et al. (2019). A phase-contrast microscope Axiovert (Zeiss model MC-80) was used to examine the colony features as well as the morphological structure of the cells. Then, strains capable of degradation were further tested through gram staining for the identification. The biochemical tests included catalase test, gelatinase test, starch hydrolysis test (amylase test), casein hydrolysis test, oxidase test, Indole production test, Methyl red test, Citrate utilization test, Nitrate reduction test and Urease test.

Molecular characterization

The isolated strains’ DNA was extracted using the Cetyltrimethylammonium Bromide (CTAB) technique (Orek, 2018). The RT PCR (QIAGEN) was used to conduct the 16S rDNA amplification process and phylogenetic analysis. The DNA obtained from the isolated strains was utilized as a template for PCR amplification using 16S rDNA primers. The forward primer for the bacterium was FD1 (AGAGTTTGATCCTGGCTCAG 20 bp), and the reverse primer was rP1 (ACGG(ACT)TACCTTGTTACGACTT, 23 bp). The PCR products were sequenced by Macrogen Inc., Seoul, Korea. The Basic Local Alignment Search Tool (BLAST) was run to analyze sequences (Altschul et al., 1990). The 16S rRNA gene sequences of selected strains were acquired from GenBank and matched with the gene sequences of our isolates using CLUSTALX. A distance matrix was constructed using the aligned sequences (Jukes & Cantor, 1969). Following the generation of 500 bootstrap sets, MEGA X version 10.2.6 was used to construct a phylogenetic tree using the neighbour-joining technique (Stecher, Tamura & Kumar, 2020).

Growth rate study

To check the efficacy of growth of pesticide degrading microbes in MSM broth, the growth curve was observed.

In a sterile conical flask holding 100 mL of MSM broth, an aliquot (1 mL) of bacterial suspension was added (Ghanem, Fahad & Abdulghafoor, 2012). The MSM composition (w/v) was 0.1% NH₄NO₃, 0.1% NaCl, 0.15% K₂HPO₄, 0.05% KH₂PO₄, 0.01% MgSO₄.7H2O, 0.0025% FeSO4, 1% glucose and incubated in a shaking incubator at 150 rpm using WiseCube Fuzzy System (model WIS-20) (Al-Thukair & Karim, 2016) at various temperatures (15 °C, 30 °C and 45 °C). The wavelength was set at 600 nm (OD600) to check cell density at different time intervals (2, 6, 8, 12, 16, 20, 24, 30 and 36 h) using an Agilent Cary 5000 Ultraviolet-to-Visible to-Near-Infrared (UV-Vis-NIR) spectrophotometer (Agilent Technologies, Petaling Jaya, Malaysia). The optimum pH of the growth media was adjusted to pH 7. The growth curve was constructed by determining the optimum culture time of each biodegrading strain at different temperature. All the experiments were done in triplicate, and a negative control with no microbial inoculation was carried under the identical circumstances.

Statistical analysis

The normality of the data was tested using the Pearson’s correlation tests for all of the data obtained. Statistical analysis was done using MS Excel 16.0.

Approval of field permit

Field experiments were approved by Research committee of the University of Agriculture Peshawar, Pakistan (Project number:27/FCPS/AUP) and National institute of biotechnology and genetic engineering (NIBGE), Faisalabad-Pakistan.

Isolation of pesticide-degrading bacteria

Through enrichment, many indigenous pesticide-tolerant bacteria with pesticides as their only carbon source were identified from contaminated soil and industrial effluents. From these enrichment cultures, 20 morphologically diverse strains were isolated on nutrient agar plates containing DDT and aldrin and malathion pesticides, respectively. These strains’ pesticide degradation ability was checked on MSM agar plates containing pesticides (50 mg/mL). The six bacterial isolates used in the degradation experiments. Isolates 1A, 2B, and 3C came from soil contaminated with DDT (from Industrial city Faisalabad). While isolates 4D, 5E and 6F were from the industrial area of Lahore, Pakistan, with DDT, aldrin and malathion contamination. Of the two locations investigated, samples from the Lahore industrial area had the highest contamination. Pesticide contamination was found in all the soils and effluents utilized to isolate microorganisms. All six isolates were correctly identified using 16S rRNA sequencing. The strain Pseudomonas was found to be the most common among the isolates.

Pesticide degradation activity

Out of 20 bacterial strains from the industrial wastes, only six (1A, 2B, 3C, 4D, 5E and 6F) showed significant degradation against all three pesticides at 50 mg/mL, which was tested. The plates were marked into small segments. The zone of degradation was plotted against the periodic time intervals shown in Figs. 1, 2 and 3 for the pesticides.

The percentage degradation of DDT pesticide was plotted against time. The isolates 1A, 2B, 3C and 4D showed highest degradation activity of 70–80% during the 36 h while 5E and 6F degraded 28–36% of the same DDT concentration (Fig. 1 and Table S1).

In the case of aldrin, a little variation in percentage values of degradation was observed when plotted against time (Fig. 2 and Table S2). The isolate 3C showed the highest degradation (78%) against aldrin, followed by 2B and 4D with 72% and 68%, respectively. In contrast, isolate 1A showed 58% degradation. The degradation values for the isolates 5E and 6F were 30% and 40%, respectively. However, 5E and 6F values were observed to be lower than 1A, 2B, 3C and 4D.

In the case of malathion, a reverse trend was observed, and highest values of 54% and 53% were recorded from F6 and E5 isolates over 1A, 2B, 3C, 4D, where degradation rate was recorded between 30–40%, as shown in Fig. 3 and Table S3.

Overall degradation of the selected bacterial isolates showed that selected locally collected bacteria could easily degrade organophosphates and organo-chlorines. However, the degradation rate can depend on both the type of bacteria and the pesticide composition, which needs to be explored further. These strains could play a useful role in achieving the safe recovery of polluted sites, particularly in a situation where pesticides, chemicals and other undesired toxic substances containing organochlorine and organo-phosphates and their variety of derivatives might persist. These isolates might also be helpful to produce beneficial microbes sensitive to such toxicities. However, the isolated strains had varying effectiveness for specific pesticides. This trend showed that strains might be applied according to the nature of pollutant present in a particular environment for eradicating toxic chemicals.

Identification and characterization of isolates

The bacterial strains were selected by analyzing their morphology and colony characteristics, indicating the microbial diversity present in the respective collected (environmental) samples. Based on the isolates’ physical appearance, the distinguishing yellow, cream, and white pigmented colonies (Fig. 4), a colonial diversity (raised and flat) was observed. When viewed under a phase-contrast microscope, the isolates were appeared with different cellular morphologies. All isolates were mostly rod-shaped, while the isolate 4D exhibited coccus shape as well. Similarly, all isolates were gram-negative and motile except 4D, which is non-motile. None of the isolates contained endospores, and none of the isolates indicated exospores. The isolates 4D, 5E and 6F were circular, while the rest are irregular in shape. The isolates 2B, 3C, and 4D have undulated colony margins whereas 1A, 5E and 6F had entire margins (Table 1). The selected isolates’ cell size was found to be 1.5 µm for 1A and 4D, while the rest of the isolates’ cell size ranges from 2.0 to 3 µm, as presented in Table 1.

PCR method for 16S rRNA amplification and Sequencing

Before sequencing all the DNA samples were amplified under optimized conditions. To obtain a PCR product of 1, 500 base pairs, universal eubacterial rDNA primers fD1 and rP1 were used (Fig. S1). Purified PCR product was sequenced commercially. A partial sequence of the 16S rRNA showed that four isolates had 97–99% homology with Pseudomonas spp. Simultaneously, the other two isolates were 97 and 96% identical to Actinobacter baumannii and Acidothiobacillus ferroxidans, respectively (Table 2).

All these sequences are deposited in the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/).

Phylogenetic analysis

Partial 16S rRNA were obtained from the NCBI (http://www.ncbi.nlm.nih.gov) web site, and they were aligned with our isolates to generate a phylogenetic tree (Fig. 5). Phylogenetic analysis showed that all five isolates have evolved from a common ancestor. They have a close relationship among themselves except 5E which shares a common ancestor but is far off from the other isolates in the tree. This showed the diversity among the isolates persists that can tolerate pesticides even at high concentration.

Estimation of bacterial growth rate

At 600nm, optical density of each isolate was recorded at various intervals i.e., 2, 8, 12, 16, 20, 24, 30 and 36 h, on MSM medium. All the isolates studied in the experiment attained an OD of around 0.7 in broth at 30 °C after 8 h, while it took more than 10 h to reach the OD of 0.7 at other temperatures, so the optimal temperature for these strains was 30 °C, as shown in Fig. 6 and Table S1. 6F showed maximum growth at different temperatures among all the isolates, while A1 showed the least. Similar results were reported by Kaya, Aslim & Kariptaş (2014) and Murad et al. (2007).

Limitations of the study

Our findings’ scope can be further improved by considering the other factors such as organic matter, pH, temperature etc., that might help to pace the specific microbes’ availability for biodegradation and their interactive association with chemicals.

Moreover, the study fails to address the extent of degradation of DDT, aldrin, and malathion: whether to their intermediate compounds or a more complete degradation. Furthermore, the enzymes contributing to the degradation ability should be isolated and studied. These deficiencies provide a topic for further investigators in this regard.