A docked mutation phenocopies dumpy oblique alleles via altered vesicle trafficking

Fly stocks

Flies were raised on a standard cornmeal, molasses, yeast and agar medium at 25°C. doc¹/TM3Sb, doc¹⁶/TM3 Sb, Ser and doc⁹⁹/TM6Tb were kind gifts from Dr. Michael Bender (Univ. of Georgia, Athens, Georgia). A strain carrying the UAS-dNSF2^E/Q construct (Stewart et al., 2001) was kindly provided by Hugo Bellen (Baylor College of Medicine,Houston, TX, USA). A UAS-RNAi-doc strain (ID#2679) was obtained from the Vienna Drosophila Research Center. dpy^DvlG5 was isolated from an EMS mutagenesis screen (T. Abbeyquaye and J. Thackeray, unpublished). All other stocks were obtained from the Bloomington Drosophila Stock Center at Indiana University.

Generating a wild type CG5484 transgenic rescue construct

DNA was extracted from wild-type canton S strain flies and PCR was carried out using Native Pfu polymerase (Stratagene Inc, La Jolla, CA, USA) according to the manufacturer’s instructions. The CG5484 transcription unit and about 1 kb of intergenic sequence on either side were amplified in two overlapping PCR products and joined using a common NsiI cut site to generate a full-length wild-type CG5484 rescue construct. The forward and reverse primers for the more 5′ product were 5′TTCGCGCTGGCTCAAACTGCCTA3′ and 5′-CCAAGAGCTCCCAGTGCAACCA-3′ respectively; the underlined base is a mismatch used to incorporate a SacI site into the product. The 3′ half of CG5484 was amplified using the primer pair 5′GCGAAGTAGTACTTAAGCTTGGC3′ and 5′-GGATGGATTCATCTAGACCTCGG-3′ respectively; the underlined base in the former is a mismatch used to incorporate a HindIII site, in the latter primer the underlined base introduces an XbaI restriction site. A 4.1 kb SacII/XbaI fragment that begins 1124 bp 5′ of the predicted translation start and ends 1,352 bp 3′ of the predicted stop codon was ligated into the pCaSpeR4 germline transformation vector. The genomic insert in this vector was verified by sequencing and then injected into white¹¹¹⁸ embryos to produce transgenic lines expressing wild-type CG5484; transgenic injection was performed by Genetic Services Inc, Sudbury, MA, USA.

Alleles of doc interact genetically with dumpy mutations

We noticed a strong similarity in wing phenotype between doc¹ homozygotes and the oblique class of dumpy (dpy) mutants, which suggested to us that Doc and Dpy may be involved in a common pathway during wing development. We outcrossed four doc alleles and confirmed their allelic status, the lethality of doc^13,16,99 and the oblique wing phenotype of doc¹ (Fig. 1). These initial experiments also revealed that doc¹ is semi-dominant: doc¹/+ heterozygotes show a very slight indentation in the distal part of the wing. Next we looked for genetic interaction between doc and dpy. We found that the oblique wing phenotype of two dominant dpy alleles, dpy^D and dpy^DvlG5 as well as a recessive allele dpy^olvr is strongly enhanced when placed in a background heterozygous for doc¹, producing a significant further reduction in wing length (Fig. 1). This interaction is consistent with Doc and Dpy playing roles in a common signaling pathway. However, two lethal alleles of doc, doc¹⁶ and doc⁹⁹, did not interact with any of these dpy alleles (data not shown), suggesting that the doc¹ mutation is qualitatively different from the other two doc alleles.

Doc is encoded by the gene model CG5484

The doc alleles were identified originally by either their lethality (doc^13,16,19) or their wing phenotype (doc¹) when heterozygous with two overlapping third chromosome deficiency chromosomes, Df(3R)ro80b and Df(3R)Tl-X (Rayburn et al., 2003), implying that the doc transcription unit lies within the genomic interval common to both deficiencies. We amplified genomic DNA from the doc mutant chromosomes, using primers in coding regions from several of the approximately 20 genes within this interval. We targeted loci predicted to encode proteins that seemed most likely to play a role in regulating signaling pathways in wing development: CG6420, CG5484, beat VII and scribbled. Nucleotide sequences from these candidate genes in various doc¹, doc¹⁶/TM3Sb and doc⁹⁹/TM6Sb backgrounds were compared to wild-type; we did not observe unique mutations in any of the candidate genes except one: CG5484. The doc¹⁶ chromosome carries a nonsense mutation in the predicted CG5484 open reading frame, affecting amino acid position 162 and therefore eliminating more than half of the predicted full length protein (Fig. 2A). However, we were unable to identify mutations in CG5484 in either the doc¹ or doc⁹⁹ chromosomes. To establish whether CG5484 corresponds to doc, we generated a wild type genomic construct containing all predicted CG5484 exons and introns, as well as approximately 1 kb of additional 5′ and 3′ sequence beyond the predicted transcription unit. A single copy of this transgene completely rescued both the oblique wing phenotype of doc¹ homozygotes and the lethality of doc¹⁶ (Figs. 2B–2D). The transgenic construct did not rescue the lethality of doc⁹⁹, but this is likely due to a tightly linked lethal mutation in another locus, because the CG5484 construct was able to rescue the lethality of doc¹⁶/doc⁹⁹ transheterozygotes (data not shown). Taken together with the nonsense mutation in the doc¹⁶ chromosome, these germline rescue experiments demonstrate that CG5484 encodes Doc. Henceforth we refer to CG5484 as docked.

doc encodes a Yif1 homolog

The FlyBase annotation of doc shows that the gene produces three slightly different mRNAs via alternative splice site usage at the 3′ end of exon one (McQuilton, Pierre & Thurmond, 2011), predicting a set of three very similar Doc isoforms: A (397aa), B (393aa) and C (402aa). Genbank searches using the longest isoform revealed that Doc has no other homologs in Drosophila (not shown). However, these searches also clearly demonstrated that Doc is a member of the YIP (Ypt-interacting protein) superfamily that was first identified in the budding yeast, S. cerevisiae (Matern et al., 2000). Comparison of Doc with the most similar YIP family members from yeast (YIF1) and human (Yif1A) shows relatively poor conservation over the N-terminal third of Doc, but the region homologous to the more C-terminal two thirds shows substantial conservation among all three species (Fig. S1). A characteristic feature of YIP family members is the presence of five likely membrane-spanning domains; a hydropathy plot of the Doc sequence reveals that these are conserved within Doc (Fig. S2). Doc shows greatest similarity to yeast Yif1 (Yip1 interacting factor), which is an integral membrane protein required for membrane fusion of ER-derived vesicles (Barrowmann et al., 2003) and is essential for ER to Golgi vesicle-mediated transport in S. cerevisiae (Heidtman et al., 2005). While we were preparing this manuscript others reported the same finding, that CG5484 is a Yif1 homolog in Drosophila (Wang, Wang & Yu, 2018).

We used PCR amplification from mRNA to confirm that the A, B and C splice forms are generated in wild-type adult tissue; these experiments also suggest that the B form is the most abundant of the three (Fig. S3). There are no reports of alternative splicing in the exons encoding the N-terminal end of the yeast or human YIF1 homologs; so we examined other insect species to determine whether the three alternative splice forms are evolutionarily conserved. All eight Drosophila species we examined show conservation of the three alternative splice donor (GT) sequences at identical locations in their respective doc homologs, suggesting that the three Doc isoforms are conserved in the other species and therefore likely to have distinct functional roles (Fig S3). In summary, the Doc sequence strongly suggests it is a YIF1 homolog and is therefore very likely to be involved in vesicle trafficking in Drosophila.

Interaction of doc with genes encoding COPII core proteins

S. cerevisiae yif1 mutants exhibit defective COPII vesicle transport (Matern et al., 2000) and its Yif1 protein product has been described as either a COPII vesicle component, or a resident of the Golgi necessary for ER-derived COPII vesicle docking (Heidtman et al., 2003; Jin et al., 2005; Matern et al., 2000). To determine whether Doc plays a similar role in Drosophila we looked for genetic interaction between doc and the genes encoding some of the core components of COPII vesicles. The COPII coat assembles by a stepwise deposition of Sar1-GTP, Sec23–Sec24, and Sec13–Sec31 onto ER exit sites (Gurkan et al., 2006). Sec23–Sec24 and Sec13–Sec31 are heteromeric protein complexes that are major constituents of the inner and outer layers of the COPII coat (Matsuoka et al., 1998). We found a strong interaction between doc and sec23 mutations: there is a noticeable enhancement of the oblique wing phenotype in doc¹ sec23^j13C8 double heterozygotes (Fig. 3), whereas the double heterozygous combination of doc¹ and sec23^9G alleles was lethal. Similarly, in a background heterozygous for sec13⁰¹⁰³¹ the oblique wing phenotype of doc¹ heterozygotes was markedly more severe compared to doc¹/+ alone (Fig. 3). In the case of sar1 we observed no change to the severity of the wing in doc¹/sar1⁰⁵⁷¹² flies, but this combination showed some evidence of semi-lethality: the number of doc¹ +/+ sar1⁰⁵⁷¹² double heterozygotes was reduced by about 40% compared to the combined number of doc¹/TM3 and sar1⁰⁵⁷¹²/TM3 siblings (six vs 30 respectively). These synergistic interactions strongly suggest a role for Doc in COPII vesicle trafficking. We did not observe any interaction in animals that were doubly heterozygous for either doc¹⁶ or doc⁹⁹ and also sec23^j13C8, sec13⁰¹⁰³¹ or sar1⁰⁵⁷¹².

Doc has roles in vesicle fusion

Studies from yeast have revealed that Yif1 forms a complex with Yip1 and interacts with Rab GTPases in the acceptor Golgi membrane, suggesting a role for Yif1 in tethering of COPII vesicles (Matern et al., 2000). Accurate matching of vesicles to the correct target depends on v-SNARE proteins in the COPII membrane forming a complex with specific t-SNAREs in the target membrane. We therefore generated heterozygous combinations of doc mutations with mutations of genes encoding either the v-SNARE component Synaptobrevin (syb), or one of the t-SNARE proteins Syntaxin (Syx), using the syntaxin 1 homolog encoded by Syx1A. We observed clear interaction between doc¹ and Syx1A, first, by a modest enhancement of the doc¹ oblique wing phenotype in doc¹ +/+ Syx1A^Δ229 flies (Figs. 3G–3I) and second, because the doc⁹⁹ mutation showed semi-lethality even in heterozygous condition if the dosage of Syx1A was also reduced using the null allele Syx1A^Δ229: the cross produced only 36% of the number of doc⁹⁹ +/+ Syx1A^Δ229 adults compared to their doc⁹⁹/TM3 sibs (five doc⁹⁹ +/+ Syx1A^Δ229 adults compared to 28 Syx1A^Δ229 /TM3 or doc⁹⁹/TM3). By contrast, we found no interaction between any doc allele tested and syb (data not shown). These results are consistent with a role for Doc in COPII vesicle fusion with the ER, and suggest a more critical involvement with events occurring on the target membrane.

Next, we investigated whether Doc might play a role further downstream of cis-membrane fusion. One aspect of this is the need for cis-residing protein complexes to be broken apart to be recycled for future trans-complex formation, maintaining anterograde vesicle transport. NSF is an ATPase involved in dissociation of SNAREs (Banerjee et al., 1996) and thus NSF may permit recycling of SNAREs to maintain a steady rate of protein transport. We perturbed dNSF function in the wing margin by expressing the dominant negative UAS-dNSF2^E/Q construct (Stewart et al., 2001) under the control of c96-GAL4, which drives expression in the wing margin (Gustafson & Boulianne, 1996), generating nicks. We found that this wing nick phenotype is enhanced in backgrounds that are heterozygous for any of doc¹, doc¹⁶ or doc⁹⁹ (Figs. 3J–3K). The interaction of doc with dNSF2 is consistent with a role for Doc in vesicle trafficking, and suggests a role for Doc that matches that of yeast Yif1 in vesicle fusion (Barrowmann et al., 2003).

doc is required broadly during development

Flies homozygous for either the doc¹⁶ or doc⁹⁹ alleles, as well as doc¹⁶/doc⁹⁹ transheterozygotes, do not survive development, with a lethal phase during embryogenesis (data not shown). Similarly, we found that expression of a UAS-doc-RNAi construct using the broadly expressed wg-GAL4 driver is lethal (data not shown). Furthermore, restricting the doc knockdown to trachea using the breathless-GAL4 driver (Matusek et al., 2006; Reichman-Fried & Shilo, 1995) was also lethal, consistent with a general requirement for Doc during organogenesis. The adult wing provides a convenient way to examine cell-lethal functions in the adult, because it is completely dispensable. RNAi knockdown of doc in the wing using the dorsal compartment driver MS1096-GAL4 resulted in complete loss of wing structures (not shown). However, restricting knockdown of doc to the dorsal-ventral (DV) wing boundary using the C96-GAL4 driver (Gustafson & Boulianne, 1996) resulted in partial loss only of marginal tissue (Fig. 4).

A role for Doc in Notch ligand transport

The wing nicks produced by targeted doc knockdown, as well as the synergistic interactions between doc alleles and mutations in genes involved in vesicle trafficking, suggests a role for Doc during export of developmentally important signaling ligands in the wing. Spatially restricted expression of the Notch (N) receptor and its ligands, Serrate (Ser) and Delta (Dl) play key roles in wing margin development (Artavanis-Tsakonas, Rand & Lake, 1999; de Celis, Garcia-Bellido & Bray, 1996; Neumann & Cohen, 1996; Panin & Irvine, 1998) and marginal wing nicks very similar to those we observed with C96 > doc-RNAi are observed in some alleles of both N and Ser (Thomas, Speicher & Knust, 1991; van de Hoef, Bonner & Boulianne, 2013). We therefore examined whether there are genetic interactions between the genes encoding these molecules and docked.

Wings of Dl⁷ mutants have thickened veins and delta-like wing venation patterns and we found that this Dl venation phenotype is enhanced by all three doc alleles tested: doc¹, doc¹⁶ and doc⁹⁹ (Figs. 4A–4C). This was manifested by much increased thickening of vein L2, as well as frequent thickening and/or delta formation at the distal ends of veins L3 and L4. A similar enhancement was observed when doc dosage was reduced in a background that was heterozygous for both Dl^RevF10 and Ser^RX82 (Figs. 4D–4F). We found a particularly strong interaction between doc and N. Halving the dosage of docked with either doc¹ or doc¹⁶ was lethal in a N^{nd − 3} heterozygous background, while in a doc⁹⁹ heterozygous background only an occasional N^{nd − 3}/+; doc⁹⁹/+ escaper was recovered; these escapers did not have any observable change in wing phenotype (not shown). These results are consistent with Notch signaling being reliant on Doc-dependent vesicle trafficking.

Our finding that at least some Notch signaling depends on Doc suggests a possible cause of the wing nicks observed in the C96 > RNAi-doc animals: failed trafficking of N or its ligands. We tested this model directly, by overexpressing Dl or Ser, using UAS-Dl or UAS-Ser constructs driven by the C96-GAL4 driver, in a background also expressing the UAS-doc-RNAi construct. We found that overexpression of Delta was sufficient to completely rescue the wing nicks resulting from RNAi knockdown of doc, whereas in the case of Serrate the rescue was strong, but not complete (Figs. 4G–4I). By contrast, overexpression of Notch using the same method did not rescue the doc-RNAi wing margin defect, although some degree of rescue was apparent in most animals (Fig. 4J). These findings strongly suggest that the wing nicks observed in C96 > RNAi-doc animals are due to reduced availability of Notch ligands, presumably as a result of lowered vesicle trafficking.

The interaction between doc and dpy is related to transport of Dpy

Animals homozygous for doc¹ are a remarkably accurate phenocopy of the oblique class of dpy mutations, and we have shown in this study that a strong genetic interaction exists between the two genes (Fig. 1). Dpy resides in the extracellular matrix (Wilkin et al., 2000), so it can be assumed to pass through the vesicular trafficking pathway to reach its final destination. Given the similarity in their phenotypes, an obvious question is whether the doc¹ wing phenotype arises from reduced transport of Dpy. If this is true, then we might expect other mutations that disturb vesicle trafficking to worsen the severity of the oblique wing phenotype in dumpy mutants. We find that this is indeed the case: whereas dpy^D heterozygotes show a barely detectable oblique phenotype, transheterozygous dpy^D/+; sec13⁰¹⁰³¹/+ and dpy^D/+; sar1⁰⁵⁷¹²/+ animals both show a much more substantial oblique phenotype (Fig. 5). By contrast, no observable change in the severity of the oblique wing phenotype was observed in trans-heterozygous combinations of dpy^D with either of two sec23 alleles, sec23^9G or sec23^j13C8 (data not shown). The interaction between dpy^D and both sec13⁰¹⁰³¹ and sar1⁰⁵⁷¹² is consistent with a model in which the doc¹ oblique wing phenotype is due to an effect occurring via Dumpy.

The interaction of dpy^D with alleles of doc, sec13 and sar1 all suggest a particular sensitivity of Dpy to reduced COPII vesicle transport, but we wondered if the same effect might be seen if vesicle trafficking at other stages was reduced. Jagunal (Jagn) is a conserved ER membrane protein required for replenishment of the ER membrane (Lee & Cooley, 2007), so we tested whether jagn mutants show any interaction with dpy^D. Although there was no observable wing phenotype in adults (not shown), we found that the transheterozygous combination of dpy^D/jagn^G4067 is semi-lethal: only 29% (four vs the expected 14) of the expected number of dpy^D/jagn^G4067 adults emerged compared to their dpy^D/+ or jagn^G4067/+ siblings. This result buttresses the idea that Dpy is highly sensitive to reduced COPII-dependent traffic, because Jagn is needed to maintain future rounds of COPII transport; it also shows that this effect is not specific to a particular stage of extracellular transport.

Halving the dosage of genes encoding components of the vesicle trafficking machinery would be expected to affect any protein that passes through the ER, and not just Dpy. We therefore looked for genetic interaction between doc and other genes encoding proteins that are similar to Dpy in any of size, amino acid sequence or extracellular location. Dpy is one of a small group of proteins that contain a ZP (zona pellucida) domain, a motif that is unique to a subset of extracellular proteins (Jovine et al., 2002); all ZP domain-containing proteins can therefore be assumed to be trafficked between the ER and Golgi to reach their final destination. Sixteen Drosophila genes encoding proteins with a ZP domain are identifiable in release six of the Drosophila genome and we examined P-insertion alleles of ten for genetic interaction with doc. Nine of these ten–dusky-like, Dusky, piopio, cypher, trynity, nyobe, nyeo, nomp-A and CG17111–showed no interaction with any of doc¹, doc¹⁶ or doc⁹⁹ when in various transheterozygous combinations (data not shown). However one member of this group, miniature, did show significant interaction with doc. Miniature is a transmembrane protein required for proper assembly of the chitin-based cuticle; adults homozygous or hemizygous for viable miniature (m) alleles have short wings (Slatis & Willermet, 1954). Wings of hemizygous m¹ males that were also heterozygous for either doc¹ or doc¹⁶ had much more abnormal wings than m¹/Y alone, being both narrow and misshapen (Figs. 5F–5H). Although the reduced size of the wings of m¹/Y; doc⁹⁹/+ males was typical of m¹ hemizygotes, there was a noticeable increase in the amount of darkly-pigmented tissue that is characteristic of some m alleles (Fig. 5I). In addition, two transheterozygous combinations of doc and m were lethal: m^{259 − 4}/+; doc¹⁶/+ and m^259-4/+; doc⁹⁹/+. By contrast, we found no interaction between doc¹ and m^{259 − 4} (data not shown).

Finally, because Dpy is an exceptionally large protein known to use a distinct trafficking pathway for bulky cargoes (Rios-Barrera et al., 2017) we wondered whether the interaction between doc¹ and dpy might also be related to the exceptional size of Dumpy. We were able to identify in Flybase only one other secreted Drosophila protein approaching its size: Mucin14A, which has a largest isoform of 16,233aa (Syed et al., 2008). We found no change in the phenotype of any of the three doc alleles when they were placed in a background heterozygous for a viable allele of Muc14A^f00286, suggesting that the interaction of Doc with Dumpy is not solely due to its large size (not shown). Because the size of Dpy could conceivably be causing other Doc-dependent effects distinct from secretion, we also tested for interactions with genes encoding six relatively large intracellular proteins sallimus (longest predicted isoform given in Flybase (St Pierre et al., 2014) 18,488aa), ankyrin2 (13,559aa), muscle-specific protein 300 (13,540aa), stretchin (9,839aa), bent (8,933aa) and shortstop (5,501aa), but found no interaction when in transheterozygous combinations with various doc alleles (not shown). These findings suggest that the interaction between doc¹ and dpy is unlikely to be due to the size of Dpy or the presence of a ZP-domain per se.

A broad role for Doc in vesicle trafficking

We found that loss of doc in the developing wing margin leads to nicks very similar to those produced by some alterations of Notch pathway signaling. Over-expression of Delta was able to restore normal development of the wing blade, indicating that reduced Notch pathway activity was responsible for the marginal nicks; in addition, this result shows that ligand availability is the limiting factor, because Serrate over-expression also produced limited rescue, whereas increased Notch receptor expression did not produce any rescue. The Delta/Serrate rescue of the RNAi-induced nicks also demonstrates that vesicle trafficking pathways are not blocked altogether by expression of the doc-RNAi construct, otherwise Delta overexpression would have no effect. This may reflect incomplete knockdown of doc⁺ by the doc-RNAi construct, but could also be explained by the presence of a redundant, and Doc-independent, mechanism of Delta transport. It is surprising to us that the doc-knockdown-induced nicks could be rescued by increased availability of a single protein, Delta, given that we would expect ER-Golgi transport of a plethora of proteins to be significantly reduced. This might reflect a role for Doc in some, but not all, COPII-mediated ER-Golgi vesicle transport, or perhaps might be due to a very brief window of expression induced by the C96-GAL4 driver, during which Delta transport is critical. However, our results do confirm that transport of other proteins also depends on Doc, because although Delta overexpression permitted normal development of cells in the wing blade, these otherwise-rescued doc-RNAi wings lack many marginal bristles (Fig. 4H). Development of these bristles is known to depend on Wingless-mediated signaling (Zhang & Carthew, 1998), so this strongly suggests that another critically important developmental ligand relies on Doc-mediated vesicle transport. We found additional evidence that Doc also plays a key role in earlier developmentally important signaling events, such as the finding that some heterozygous combinations of N and doc alleles generated synthetic lethality. These results are consistent with a broad role for Doc in vesicle trafficking.

The link between doc and dumpy

We originally became interested in docked because doc¹ homozygous flies show an indentation in the distal tip of the wing that is indistinguishable from the phenotype observed in the oblique class of dumpy alleles, raising the possibility that the two genes are functionally connected. We have been able to show here, in two distinct ways, that the similarity in phenotype indeed reflects a common mechanism. First of all, there is a strong non-additive interaction between doc¹ and three different dpy alleles, perhaps the most striking example being between dpy^olvr and doc¹. Heterozygous animals for the former have wild-type wings, and doc¹ heterozygotes have only a very slight truncation at the distal tip of the wing; by contrast, animals heterozygous for both doc¹ and dpy^olvr show a strong oblique phenotype (Fig. 1). Second, having shown that Doc encodes a protein likely to be involved in ER-Golgi transport we found that reduced dosage of sar1 and sec13, both of which encode elements of COPII vesicles, also produces a marked enhancement of the oblique wing phenotype of dpy^D. This unambiguously establishes that reduced COPII vesicle trafficking exacerbates dumpy oblique mutations, presumably by limiting transport of Dpy during wing development. Therefore, given that Doc also plays a role in vesicle trafficking, the simplest explanation of the dumpy-like wing truncation of doc¹ is that it results from reduced availability of Dpy. This model has an additional implication: if an oblique wing phenotype can be produced by reducing the concentration of wild-type Dpy in the wing, then the simplest explanation of the dumpy oblique alleles is that they are hypomorphs. Also consistent with this model is the sensitivity we observed of Dpy to reduced vesicle trafficking, for example in the much-increased oblique wing we observed in dpy^D when dosage of sar1 or sec13 was halved (Fig. 5).

The precise lesion in a large collection of dpy mutations has been determined, revealing that most alleles are caused by truncating mutations: premature stop codons, deletions or those affecting splice sites (Carmon et al., 2010). However, the majority of the non-lethal oblique alleles show a different pattern, not only because the mutations are clustered in a single exon, but also because they are missense. Based on patterns of sequence conservation described in the same study, it was proposed that this exon is alternatively spliced. It may be then that dpy^o mutations reduce the availability of a wing-specific isoform, resulting in the observed combination of a homozygous viable, oblique wing phenotype. However, it remains something of a mystery what role might normally be played by such a wing-specific Dumpy isoform, and how a reduced amount of it generates reduced growth in such a specific location. The exon in which the non-lethal oblique mutations occur contains several EGF repeats, so one possibility is that these repeats are modified by Eogt in a way that is necessary for Dpy function during wing morphogenesis.

A puzzling aspect of the doc-dpy interaction is why the enhanced dumpy oblique phenotypes are only observed with doc¹, and not the lethal alleles doc¹⁶ and doc⁹⁹. If the interaction between doc¹ and dumpy is simply from restricted ER-Golgi transport of Dpy, we would expect reduced dosage of the more severe alleles of doc to enhance the oblique wing phenotype of dpy alleles at least as much as doc¹. Part of the answer to this puzzle, as discussed above, probably rests on the unresolved qualitative difference between the doc¹ and doc^16/99 alleles. However, the range of doc allele phenotypes also echoes the behavior of the different classes of dpy alleles, which can produce three phenotypes (lethality, thoracic vortices, oblique wings) alone, or in any combination with each other (Carlson, 1959). It may be that this is an example of an allele-specific interaction, perhaps due to a neomorphic change in the doc expression pattern in the developing wing in doc¹ that is absent from the other doc alleles.

Given that Doc likely functions as a component of the ER-Golgi trafficking machinery, it would be surprising if the interaction we observed between doc and dpy is unique; unless Doc is only involved in trafficking a limited range of cargoes, interactions with other genes encoding secreted or membrane-bound proteins would be expected. The size of Dpy does not appear to be a critical determinant of the interaction, because we found no hint that mutation of several other genes encoding large cargoes results in a genetic interaction with doc. Dpy contains a ZP domain, so we looked for genetic interaction with ten different genes encoding ZP domain proteins; these all share a similar final destination, and may have related roles (Jovine et al., 2002) In this case we did find one gene with a clear interaction: miniature. Again, the interaction does not point toward size as being important, because Min is of an unremarkable size, only 682 amino acids long. The interaction extended to multiple alleles of both genes and was non-additive, producing markedly enhanced miniature phenotypes with just a halving of doc dosage, even with doc alleles that have no wing phenotype on their own. In combination with a small deficiency that uncovers miniature, Df(1)m259 − 4, heterozygous combinations of two doc alleles with no phenotype alone generated a synthetic lethal when combined. Presumed loss of function miniature alleles are homozygous viable (Roch, Alonso & Akam, 2003), so this lethality must depend on the combined effect of reduced m dosage in the context of reduced transport of other molecules, resulting from the lowered availability of Doc. What then is the common feature underlying the strong doc-dpy and doc-m interactions? Dpy and Min are both components of the ECM, and it has become clear that, in addition to a variety of structural functions, the ECM is intimately involved in regulating the distribution, activation and delivery of a wide variety of hormones and morphogens (Hynes, 2009). This seems to be the case for Min, because recent evidence suggests that a major role for Min in the wing is in regulating diffusion of the insect tanning hormone Bursicon through the ECM (Bilousov, Kozeretska & Katanaev, 2012). It may be that reduced dosage of m, in combination with a doc-dependent reduction in traffic of both Min and other ECM components such as Dpy, disrupts Bursicon signaling enough to produce the enhanced miniature wing phenotypes.

Although the precise role of Yif homologs in vesicle transport remains uncertain, the function of the Yip-Yif complex is highly conserved in eukaryotes. This was most dramatically demonstrated in yeast, by rescue of the lethal defect in Yip1 mutants when transformed with a vector expressing human YIP1A (Chen & Collins, 2005). Functional conservation of this family from fungi to mammals suggests very strongly that Doc is likely to play a similar role in Drosophila. We have shown here that doc encodes the sole Yif homolog Drosophila and anticipate that further study of docked may help to clarify the role Yif proteins in vesicle trafficking in eukaryotes.