Identification of a pathogen causing fruiting body rot of Sanghuangporus vaninii

Isolation and purification of pathogens

Disease symptoms of S. vaninii were observed in a greenhouse at Hangzhou Academy of Agricultural Sciences, located in Zhejiang province, China (120°0′88″E, 30°1′63″N) between late June and late July 2020. Ten diseased cultivation bags were collected, and samples were taken from the junction of the diseased and healthy areas of each bag and plated onto potato dextrose agar (PDA) containing 0.25 g chloramphenicol. The plates were then incubated at 25 °C. After 7 days of incubation, agar blocks (5 mm in diameter) were cut from the growing edge of colonies and inoculated onto fresh PDA, and this process was repeated several times to obtain putative pure pathogens.

Pathogenicity assay

To conduct the pathogenicity assay, we prepared a conidial suspension (1 × 10⁶ spores/mL) using five representative isolates. At the end of the vegetative growth stage of S. vaninii, a semicircle was cut in the middle of the plastic bags to somatic part of the mycelia in the air. Then, 500 μL of the pathogen’s conidial suspension was inoculated into the areas surrounding the initial fruiting bodies of S. vaninii. The bags were incubated for 10 days at 25 °C and a relative humidity of 98%, and each isolate was tested in triplicate. Uninoculated bags were used as controls. Disease symptoms were observed and recorded, and the pathogens were isolated again from the diseased sites to confirm their morphological characteristics.

Morphological identification

To identify the fungal pathogens, ten representative isolates were cultured on potato dextrose agar (PDA), CMD (cornmeal agar 20 g, dextrose 20 g, agar 20 g with 1 L distilled water) and SNA (KH₂PO₄ 1 g, KNO₃ 1 g, MgSO₄•7H₂O 0.5 g, KCl 0.5 g, glucose 0.2 g, sucrose 0.2 g, agar 15 g with 1 L distilled water) (Jaklitsch, 2009), and incubated at 23 °C under a 12-h light/dark cycle. The structure of conidiophores, phialides, and conidia were observed and measured using a Zeiss Axiophot 2 microscope equipped with an Axiocam CCD camera and Axiovision digital imaging software (Axio-Vision Software Release 3.1., v.3–2002; Carl Zeiss Vision Imaging Systems, Jena, Germany), as previously described (Tomah et al., 2020).

Molecular analysis

To analyze the ITS region and the genes involved in taxonomy, ten isolates of pathogens were grown in 100 mL potato dextrose broth (PDB) on a shaker at 180 rpm, 25 ± 1 °C for 3 days. Genomic DNA was extracted using the Ezup Column Bacteria Genomic DNA Purification Kit (Sangon Biotech Co., Shanghai, China) according to the manufacturer’s instructions. The ITS rDNA regions were amplified using the primer pairs ITS5 (5′GGAAG TAAAAGTCGTAACAAGG3′) and ITS4 (5’TCCTCCGCTTATTGATATGC3′) (Jiang et al., 2016). The purified PCR product was sequenced in both directions and edited by BioEdit 7.1.3.0. and compared with homologous sequences available in the NCBI databases using BLAST.

Multiple alignment of the ITS rDNA sequences of this study and sequences from NCBI database (type strains of Trichoderma species, containing some species reported to be harmful to edible mushroom and some species closely related to the isolated strains) was carried out using Clustal W and a phylogenetic tree was constructed using MEGA 6. The evolutionary history was inferred by using the maximum likelihood (ML) method based on the Jukes-Cantor model (da Silva et al., 2017). The ML method was used to construct the phylogenetic tree with 1,000 bootstrap frequency. The type strain Sphaerostilbella lutea CBS 405.59 was used as the outgroup (Perera et al., 2023).

Temperature stability assay

Temperature stability was assessed by investigating in vitro mycelial growth at different temperatures. Isolate disks (5 mm diameter) were cultured on PDA plates and incubated in the dark at 5 °C, 15 °C, 25 °C, 30 °C, and 35 °C, each temperature treatment three replicates respectively. After 48 h, the diameters of the mycelial colonies were measured. Through diameter comparison, the temperature range suitable for the growth of the isolate was selected to continue the next experiment.

The inhibition of pathogenic isolate on mycelial growth of S. vaninii at different temperatures was observed by dual-culture test (Zang et al., 2023). Disks (5 mm diameter) of S. vaninii were placed on one side of PDA plates and incubated in the dark at 15 °C, 25 °C, and 30 °C, each temperature treatment three replicates respectively. Seven days later (to compensate for the slower growth of S. vaninii), disks of pathogenic isolate were placed on the other side and continued to incubate at the same temperature. The plates with only one disk of S. vaninii without pathogenic isolate were used as controls. After another 9 days, the radius of the mycelial colonies of S. vaninii was measured.

Analysis of variance (ANOVA) was done using SPSS 20.0 software program (SPSS Inc., Chicago, IL, USA). Mean value and standard deviation of each experiment were grouped according to S-N-K multiple range test with significance level of 5%. Dunnett’s test (P < 0.05) was also used to compare treatment plots with positive and negative control plots in the experiments.

Disease symptoms and pathogen isolation

During the process of artificial cultivation, disease symptoms typically occurred around the timing of fruiting body production of S. vaninii. After the somatic growth of S. vaninii in a cultivation bag ended, a semi-circular area in the middle of the bag was cut to expose a part of mycelia for the development of fruiting bodies. Pathogen contamination manifested as white hyphae covering the surface of the exposed area or by infecting the initial small fruiting body. Subsequently, green spores appeared on the white mycelium (Fig. 1A). The entire exposed substrate or the fruiting body could be covered by the pathogen mycelium (Fig. 1B), thus preventing development or further development of the fruiting body. The disease symptoms were similar to those caused by Tricoderma spp. in green mold disease on other mushrooms. After purification, five representative single-spore isolates (YZB-1 to YZB-5) were collected for pathogenicity testing and identification.

Pathogenicity tests

A spore suspension of the five isolates was inoculated into the exposed area nearby the developing fruiting body of S. vaninii, and white hyphae developed rapidly. Ten days after inoculation, a lot of hyphae with a green mold layer covered the exposed substrate and surrounded the developing fruiting body (Fig. 1C). All of the inoculated bags showed the same symptoms as the natural incidence, whereas the control treatment remained symptomless. The five isolates were separated from the inoculated bag again (YZB-1-P to YZB-5-P).

Morphological identification of pathogens

The colony characteristics of all ten isolates were similar. On PDA, the colonies were floccose with massive conidiation covering the whole surface of the plate (Fig. 2A). On CMD, isolates had a flat colony with aerial mycelium (Fig. 2B). Conidiophores and conidia were produced concentrically or near the margin of the plate. On SNA, they were relatively sparse (Fig. 2C). Conidiophores were gliocladium-like, arising from aerial hyphae, straight, 42–75 μm long (n = 30), generally unbranched (Fig. 2D), and sterile near the base, branching irregularly near the tip, with each branch terminating in a whorl of 3–6 phialides; metulae and phialides arose at narrow angles. Phialides were lageniform or ampulliform, 8.5–9.0 × 3.9–4.2 μm at the widest point. Conidia were green, smooth, subglobose, 4.2–4.5 × 3.9–4.0 μm (Fig. 2E). The isolates were similar to T. virens Gli 21, as described by Chaverri, Samuels & Stewart (2001). They are markedly different from the reported Trichoderma species in terms of spore size, color and location of colonization, phialides morphology and number of branches, and so on (Tomah et al., 2020; An et al., 2022).

Molecular analysis

The DNA from ten isolates was amplified using the primer pairs ITS5/ITS4. Sequence alignment results showed that the ITS nucleotide identity of all isolates was 100%. One isolate, YZB-1, was selected for subsequent analysis, and the ITS fragments were approximately 630 bp in length. The accession number in GenBank is MZ220425.1. Phylogenetic analysis was performed using ITS sequences from 31 type strains of Trichoderma species and one outgroup type strain Sphaerostilbella lutea. The resulting phylogenetic tree showed that all strains were separated into different clades (Fig. 3), and most reference strains could be distinguished on the species level. Strain YZB-1 was clustered together with T. virens. These data confirmed that YZB-1 is a member of T. virens.

Temperature stability assay

The mycelial growth of T. virens strain YZB-1 was significantly affected by different incubation temperatures (Fig. 4). The mycelia grew fastest at 25 °C, with an average colony diameter of 57.67 ± 2.52 mm. At temperatures above or below 25 °C, mycelium growth gradually slowed down. At 5 °C, the mycelia stopped growing. Dual-cultures of T. virens and S. vaninii were performed at temperatures suitable for pathogen growth (15 °C, 25 °C, and 30 °C). The inhibition rate of T. virens on S. vaninii mycelium was highest when incubated at 25 °C (79.01 ± 2.79%), with significant differences in inhibition rates at the three temperatures (Fig. 5C). Trichoderma virens not only occupied the medium surface more quickly with mycelial growth but also produced more green spores at the intersection of T. virens and S. vaninii (Fig. 5B).