Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica
- Published
- Accepted
- Subject Areas
- Biodiversity, Molecular Biology, Plant Science
- Keywords
- Genetic diversity, Jatropha curcas, SCARs markers, EST-SSR, nrDNA-ITS region
- Copyright
- © 2017 Vásquez-Mayorga et al.
- Licence
- This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ Preprints) and either DOI or URL of the article must be cited.
- Cite this article
- 2017. Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica. PeerJ Preprints 5:e2469v2 https://doi.org/10.7287/peerj.preprints.2469v2
Abstract
We estimated the genetic diversity of 50 Jatropha curcas Costa Rican samples using 18 EST-SSR, one G-SSR and nrDNA-ITS markers. We also evaluated the phylogenetic relationships among samples using nuclear ribosomal ITS markers. Non-toxicity was also evaluated using G-SSRs and SCARs markers. A Neighbor-Joining (NJ) tree and a Maximum Likelihood (ML) tree were constructed using SSR markers and ITS sequences, respectively. Heterozygosity was moderate (He = 0.346), but considerable when compared to worldwide values for J. curcas. The PIC (PIC = 0.276) and inbreeding coefficient (f = -0.102) were both low. Clustering was not related to the geographical origin of accessions but Costa Rican J. curcas consistently clustered as a separate group. International accessions clustered independently of collection sites suggesting a lack of genetic structure, probably due to a wide distribution of this crop and ample gene flow. Molecular markers identified only one non-toxic accession (JCCR-24) from Mexico. This work is part of a countrywide effort to characterize the genetic diversity of Jatropha curcas germplasm bank in Costa Rica.
Author Comment
Minor changes has been done as describe here:
1/18 Change to Ileana instead of Ilenana
4/18 Table 1. Change Capulín instead of Capulin and Diquís instead of Diquis
5/18 Include dashes in sentence "and JCITS- 2-R (5´- CCTGGGGTCGCGATGTGAGCGT -3´ )"
5/18 Content instead of content. Please change to capital C
7/18 Insert (JCT27, JcSSR-26 and JCT31). Insert after the word "markers" in text
Answers to specific questions in last page:
Q1 Affiliations checked, they are accurate
Q2 The citation is now correct
Q3 Text provided correspond to titles. We agree the current version.
Supplemental Information
Costa Rica map
Supplementary information (S 1). Map of Costa Rica with sampling sites were Jatropha curcas accessions were collected.
Raw data from SSR markers
Raw data 1. Results obtained with molecular markers using Powermarker 3.25 software (Liu & Muse, 2005).
Raw data with resuts from Power marker
Raw data 2. Results obtained with molecular markers using Powermarker 3.25 software (Liu & Muse, 2005).
Raw data from Power marker
Raw data 3. Results obtained with molecular markers using Powermarker 3.25 software (Liu & Muse, 2005).
Raw data form power marker
Raw data 4. Results obtained with molecular markers using Powermarker 3.25 software (Liu & Muse, 2005).
Alignment for ITS sequences
Raw data 5. Alignment for ITS sequences obtained from ITS primers.