The Xanthomonas Ax21 protein is processed by the general secretory system and is secreted in association with outer membrane vesicles
- Published
- Accepted
- Subject Areas
- Agricultural Science, Genetics, Microbiology, Molecular Biology, Plant Science
- Keywords
- Xanthomonas, XA21, PAMPs, secretion, Rice, outer membrane vesicles, plant immunity
- Copyright
- © 2013 Bahar et al.
- Licence
- This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
- Cite this article
- 2013. The Xanthomonas Ax21 protein is processed by the general secretory system and is secreted in association with outer membrane vesicles. PeerJ PrePrints 1:e109v1 https://doi.org/10.7287/peerj.preprints.109v1
Abstract
Pattern recognition receptors (PRRs) play an important role in detecting invading pathogens and mounting a robust defense response to restrict infection. In rice, one of the best characterized PRRs is XA21, a leucine rich repeat receptor-like kinase that confers broad-spectrum resistance to multiple strains of the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo). In 2009 we reported that an Xoo protein, called Ax21, was secreted by a type I-secretion system and that it served to a ctivate X A 21 -mediated immunity. This report has recently been retracted. Here we present data that corrects our previous model. We first show that Ax21 secretion does not depend on the predicted type I secretion system and that it is processed by the general secretion (Sec) system. We further show that Ax21 is an outer membrane protein, secreted in association with outer membrane vesicles. Finally, we provide data showing that ax21 knockout strains do not overcome XA21-mediated immunity.
Author Comment
This manuscript was submitted for review with PeerJ. The first two authors have equally contributed to the paper.
Supplemental Information
Ax21 secretion via OMVs is conserved in X. euvesicatoria and Xcc
Both strain were grown in Ax21-enriching conditions as described for Xoo, and cell-free supernatants were centrifugation at 180,000 g for 2 h to pellet OMVs. Samples were then subjected to Western blot analysis with an anti-Ax21 antibody. Input: cell-free supernatant before centrifugation; ultra supernatant,:supernatant after ultracentrifugation; ultra pellet: OMVs pellet after ultracentrifugation that was resuspended in 200 μL of water. Ax21 is absent from supernatants after ultracentrifugation indicating that it is in the insoluble fraction of OMVs
Topology prediction of Ax21
Predicted membrane topology from BOCTOPUS ( Hayat & Elofsson, 2012 ) . Predicted transmembrane β-strands are shown in grey; inner membrane loops are in red; outer membrane loops are in blue. B. Two-dimensional rendering of the predicted Ax21 topology from PRED-TMBB. For both A and B, the numbering begins from the first amino acid of the processed Ax21
Ax21 is embedded in the outer membrane
OMVs were purified as described in Materials and Methods and were then treated with Proteinase K and/or 0.1% Triton X-100 for 30 min. While most proteins in the OMVs preparation were degraded by proteinase K, as can be seen in the “Pro K”- treated lanes (CBB straining, left panel), Ax21 remained at the same level as in non-treated samples (Western blot, right panel), indicating that it is embedded in the outer membrane. Some degradation of Ax21 can be observed only when proteinase K treatment was combined with the Triton x-100 detergent
Ax21 secretion is enhanced under enrichment conditions
PXO99 was grown under regular, or enrichment conditions and tested for Ax21 presence in the cell-free supernatants. Under regular conditions, PXO99 was grown until an OD600 of ~2.0 in YEB, then the cells were pelleted by centrifugation. The supernatant was filtered using 0.22 mM filter (supernatant). This sample was further concentrated x10 using a 3kDa Centricon. The enrichment sample was prepared as described before and supernatant was concentrated in the same manner as for YEB. Western blot were done using the anti-Ax21 antibody
Validation of the PXO99∆ax21 insertion mutant
The ax21 insertion mutant described in this paper (named here PXO99∆ax21-2) and a mislabeled ax21 mutant strain in our collection (named here PXO99∆ax21-1) were tested by (A) PCR, (B) Southern blot and (C) Western blot analyses. A, PCR primers for the full-length ax21 ORF were used (forward primer- CGCCATATGAAGACTTCTTTGCTGGCCCT; reverse primer- CGCGGATCCTTACCAGCTGAAGCGCGG; (in bold are sequences for restriction enzymes used for cloning). A wild type PCR band is expected to yield a ~600 nt band, whereas a version with an insertion is expected to include an additional 1.2 kb for the kanamycin resistance gene, hence ~1.8 kb. B, Southern blot analysis was carried out by purifying bacterial genomic DNA followed by MscI digest and then probed with a labeled 1.2 kb kanamycin resistance gene. The predicted size for a correct ax21 insertion mutant is 4227 bp. C, Western blot analysis on total cells using the anti-Ax21 antibody as described in Material and Methods section. For each assay the wild type PXO99 strain, the PXO99∆ax21-2 insertion mutant strain showing the correct DNA profile and the mislabeled PXO99∆ax21-1 strain showing an incorrect DNA profile are shown
In planta bacterial growth curve analysis shows that the PXO99∆ax21 validated insertion mutant is not virulent on TP309-XA21
Bacterial growth in planta was assessed as described in the Materials and Methods section. When inoculated on the TP309-XA21 rice line (right panel), PXO99∆ax21 does not grow to higher levels than PXO99, while the control, XA21-virulent strain PXO99∆raxST, grows to significantly higher numbers than both PXO99 and PXO99∆ax21 at 8 and 12 dai. On TP309 (right panel) the PXO99∆raxST shows lower cell titer only at the 12 dai point. Each time point represents an average of 6 leaves ± SE. Statistical analysis was done for each time point using the Tukey-Kramer HSD test. Asterisk represents significant difference at p<0.05