Visitors   Views   Downloads
NOT PEER-REVIEWED
"PeerJ Preprints" is a venue for early communication or feedback before peer review. Data may be preliminary.

A peer-reviewed article of this Preprint also exists.

View peer-reviewed version

Supplemental Information

Ax21 secretion via OMVs is conserved in X. euvesicatoria and Xcc

Both strain were grown in Ax21-enriching conditions as described for Xoo, and cell-free supernatants were centrifugation at 180,000 g for 2 h to pellet OMVs. Samples were then subjected to Western blot analysis with an anti-Ax21 antibody. Input: cell-free supernatant before centrifugation; ultra supernatant,:supernatant after ultracentrifugation; ultra pellet: OMVs pellet after ultracentrifugation that was resuspended in 200 μL of water. Ax21 is absent from supernatants after ultracentrifugation indicating that it is in the insoluble fraction of OMVs

DOI: 10.7287/peerj.preprints.109v1/supp-1

Topology prediction of Ax21

Predicted membrane topology from BOCTOPUS ( Hayat & Elofsson, 2012 ) . Predicted transmembrane β-strands are shown in grey; inner membrane loops are in red; outer membrane loops are in blue. B. Two-dimensional rendering of the predicted Ax21 topology from PRED-TMBB. For both A and B, the numbering begins from the first amino acid of the processed Ax21

DOI: 10.7287/peerj.preprints.109v1/supp-2

Ax21 is embedded in the outer membrane

OMVs were purified as described in Materials and Methods and were then treated with Proteinase K and/or 0.1% Triton X-100 for 30 min. While most proteins in the OMVs preparation were degraded by proteinase K, as can be seen in the “Pro K”- treated lanes (CBB straining, left panel), Ax21 remained at the same level as in non-treated samples (Western blot, right panel), indicating that it is embedded in the outer membrane. Some degradation of Ax21 can be observed only when proteinase K treatment was combined with the Triton x-100 detergent

DOI: 10.7287/peerj.preprints.109v1/supp-3

Ax21 secretion is enhanced under enrichment conditions

PXO99 was grown under regular, or enrichment conditions and tested for Ax21 presence in the cell-free supernatants. Under regular conditions, PXO99 was grown until an OD600 of ~2.0 in YEB, then the cells were pelleted by centrifugation. The supernatant was filtered using 0.22 mM filter (supernatant). This sample was further concentrated x10 using a 3kDa Centricon. The enrichment sample was prepared as described before and supernatant was concentrated in the same manner as for YEB. Western blot were done using the anti-Ax21 antibody

DOI: 10.7287/peerj.preprints.109v1/supp-4

Validation of the PXO99∆ax21 insertion mutant

The ax21 insertion mutant described in this paper (named here PXO99∆ax21-2) and a mislabeled ax21 mutant strain in our collection (named here PXO99∆ax21-1) were tested by (A) PCR, (B) Southern blot and (C) Western blot analyses. A, PCR primers for the full-length ax21 ORF were used (forward primer- CGCCATATGAAGACTTCTTTGCTGGCCCT; reverse primer- CGCGGATCCTTACCAGCTGAAGCGCGG; (in bold are sequences for restriction enzymes used for cloning). A wild type PCR band is expected to yield a ~600 nt band, whereas a version with an insertion is expected to include an additional 1.2 kb for the kanamycin resistance gene, hence ~1.8 kb. B, Southern blot analysis was carried out by purifying bacterial genomic DNA followed by MscI digest and then probed with a labeled 1.2 kb kanamycin resistance gene. The predicted size for a correct ax21 insertion mutant is 4227 bp. C, Western blot analysis on total cells using the anti-Ax21 antibody as described in Material and Methods section. For each assay the wild type PXO99 strain, the PXO99∆ax21-2 insertion mutant strain showing the correct DNA profile and the mislabeled PXO99∆ax21-1 strain showing an incorrect DNA profile are shown

DOI: 10.7287/peerj.preprints.109v1/supp-5

In planta bacterial growth curve analysis shows that the PXO99∆ax21 validated insertion mutant is not virulent on TP309-XA21

Bacterial growth in planta was assessed as described in the Materials and Methods section. When inoculated on the TP309-XA21 rice line (right panel), PXO99∆ax21 does not grow to higher levels than PXO99, while the control, XA21-virulent strain PXO99∆raxST, grows to significantly higher numbers than both PXO99 and PXO99∆ax21 at 8 and 12 dai. On TP309 (right panel) the PXO99∆raxST shows lower cell titer only at the 12 dai point. Each time point represents an average of 6 leaves ± SE. Statistical analysis was done for each time point using the Tukey-Kramer HSD test. Asterisk represents significant difference at p<0.05

DOI: 10.7287/peerj.preprints.109v1/supp-6

Additional Information

Competing Interests

Pamela Ronald is an Academic Editor for PeerJ.

Author Contributions

Ofir Bahar conceived and designed the experiments, performed the experiments, analyzed the data, wrote the paper.

Rory N Pruitt conceived and designed the experiments, performed the experiments, analyzed the data, wrote the paper.

Dee Dee Luu performed the experiments, analyzed the data, commented on the manuscript.

Benjamin Schwessinger performed the experiments, analyzed the data, commented on the manuscript.

Randy Ruan performed the experiments, analyzed the data.

Lisa Fontaine-Bodin analyzed the data, commented on the manuscript.

Ralf Koebnik analyzed the data, commented on the manuscript.

Pamela Ronald conceived and designed the experiments, analyzed the data, wrote the paper.

Grant Disclosures

The following grant information was disclosed by the authors:

This work was supported by a US-Israel Binational Science Foundation (BSF) grant 2011062.

Funding

This work was supported by a US-Israel Binational Science Foundation (BSF) grant 2011062. The work of OB was supported by a Binational Agricultural Research and Development Fund (BARD) post doctoral fellowship FI-433-10. The work of BS was supported by a Human Frontier Science Program long term post doctoral fellowship The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.


Add your feedback

Before adding feedback, consider if it can be asked as a question instead, and if so then use the Question tab. Pointing out typos is fine, but authors are encouraged to accept only substantially helpful feedback.

Some Markdown syntax is allowed: _italic_ **bold** ^superscript^ ~subscript~ %%blockquote%% [link text](link URL)
 
By posting this you agree to PeerJ's commenting policies