Visitors   Views   Downloads

Multilocus phylogeny of the parasitic wasps in the tribe Euphorini (Hymenoptera: Braconidae) with revised generic classifications

View article
Multilocus phylogeny of the parasitic wasps in the tribe Euphorini (Hymenoptera: Braconidae) with revised generic classifications https://t.co/exrM6MWpcn https://t.co/m61UsUfu3Z
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
Multilocus phylogeny of the parasitic wasps in the tribe Euphorini (Hymenoptera: Braconidae) with revised generic classifications https://t.co/2aCJV4QdVU https://t.co/2aCJV4QdVU
Multilocus phylogeny of the parasitic wasps in the tribe Euphorini (Hymenoptera: Braconidae) with revised generic classifications https://t.co/2aCJV4QdVU https://t.co/2aCJV4QdVU
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
RT @ymilesz: The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of…
87 days ago
The second chapter of my dissertation is published OA at @thePeerJ, we (@BSharanowski et al.) built a multilocus phylogeny of Euphorini braconids, and updated the generic concepts of Peristenus and Leiophron. 2/3 chapters down, 1 more to go! https://t.co/dnUuwGNMPe
Multilocus phylogeny of the parasitic wasps in the tribe Euphorini (Hymenoptera: Braconidae) with revised generic classifications https://t.co/n8rf2qYxZZ @thePeerJ https://t.co/2EoCuXSN3w

Introduction

Braconid wasps in the large and diverse subfamily Euphorinae is divided into 14 tribes and 52 genera (Stigenberg, Boring & Ronquist, 2015). Euphorines attack a variety of host life stages ranging from nymphal/larval hosts to adults of seven different orders of insects: Coleoptera, Hemiptera, Hymenoptera, Neuroptera, Orthoptera, Psocodea, and Lepidoptera (Shaw, 1988; Chen & Van Achterberg, 1997; Stigenberg, Boring & Ronquist, 2015). The tribe Euphorini Foerster contains koinobiont endoparasitoids of Hemiptera and Psocodea, which attack young nymphs (1st or 2nd instar) and feed internally on the hemolymph of their hosts (Loan, 1974b). Mature parasitoid larvae emerge from mature host nymphs or teneral adults, and overwinter as pupae in soil (Loan, 1974b). Several species of Euphorini have been extensively studied for their use in biological control programs because they attack many serious agricultural pests such as Lygus Hahn (Day, 1987; Haye et al., 2005; Haye et al., 2007). Despite the research interest using Euphorini wasps in applied entomology, the classification and identification of these parasitoids remains challenging. Variable morphological characters such as the degree of completion of the occipital carina, and the presence or absence of vein (RS + M)a and cu-a were used as defining characters (Chen & Van Achterberg, 1997; Stigenberg, Boring & Ronquist, 2015), leading to taxonomic uncertainty and misidentification.

The taxonomic history of Euphorini is a long and convoluted one. Euphoriana Gahan, Euphoriella Ashmead, Euphorus Nees, and Peristenus Foerster have all been synonymized under or treated as subgenera of Leiophron in a variety of combinations by different authors (Marshall, 1887; Muesebeck, 1936; Loan, 1974a; Shaw, 1985; Shaw, 1987; Chen & Van Achterberg, 1997; Stigenberg, Boring & Ronquist, 2015). In addition, Aridelus Marshall, Chrysopophthorus Goidanich, Cryptoxilos Viereck, Holdawayella Loan, Mama Belokobylskij, and Wesmaelia Foerster were also included in Euphorini until the most recent comprehensive revision of the entire subfamily Euphorinae by Stigenberg, Boring & Ronquist (2015). Only a few exemplars of Euphorini were included in the study, but the monophyly of the tribe was strongly supported. Currently there are three recognized genera within Euphorini, including Leiophron sensu lato, Peristenus, and the monotypic Mama (Stigenberg, Boring & Ronquist, 2015). Leiophron is further divided into four subgenera, Euphoriana, Euphoriella, Euphorus, and Leiophron sensu stricto (Stigenberg, Boring & Ronquist, 2015).

Here, we extensively sample Euphorini wasps and reconstruct the evolutionary relationships among its members using a multi-locus dataset. We reassess the generic and subgeneric concepts of Euphorini and revise the classification to reflect the phylogeny. The results of this study provide a comprehensive framework for phylogenetic relationships among Euphorini wasps and we provide taxonomic clarity and identification resources to aid future applied research and biological control programs.

Materials & Methods

Sample collection

Specimens were borrowed from the following institutions and curators: Hymenoptera Institute Collection, University of Kentucky (HIC, M. Sharkey), French National Museum of Natural History (MNHN, C. Villemant), Swedish Museum of Natural History (NHRS, H. Vårdal), and Zoological Institute of Russian Academy of Sciences (ZIN, S. Belokobylskij). Additional specimens were collected via sweep netting or Malaise trap samples from Canada, USA, and Peru. Specimens were identified using Chen & Van Achterberg (1997), Loan (1974a), Loan (1974b), Stigenberg & Van Achterberg (2016). Outgroups included representatives of the most closely related tribes to Euphorini, based on Stigenberg, Boring & Ronquist (2015): Microctonus Wesmael (Perilitini), Townesilitus Haeselbarth & Loan (Townsilitini), and Chrysopophthorus Goidanich (Helorimorphini). A list of the specimens utilized in this study is provided in Table 1, and detailed locality information in Table S1. A map of the distribution of these specimens is depicted in Fig. 1, which was generated using ArcMap v10.5.1. For ease of interpretation of results, specimen information was added to taxon labels for the phylogenetic analyses, including country and lowest identification. The subgeneric names within Leiophron s.l. are used as specimen names to avoid confusion with Leiophron s.s. (eg. Leiophron (Leiophron) uniformis is listed as Leiophron uniformis, whereas Leiophron (Euphoriana) dispar is listed as Euphoriana dispar).

Table 1:
Specimen information.
GenBank accession numbers (new sequences generated for this study is in bold), collection localities, and voucher deposition institutes for all specimens used in this study. HIC (Hymenoptera Institute, University of Kentucky, Lexington), MNHN (French National Museum of Natural History, Paris), NHRS (Swedish Museum of Natural History, Stockholm), UCFC (University of Central Florida Collection of Arthropods, Orlando), ZIN (Zoological Institute of Russian Academy of Sciences, St. Petersburg).
Taxon Label COI 28S CAD Locality Voucher location
07_Yves_Leiophron_PNG MG926854 MG913702 Papua New Guinea MNHN
08_Yves_Leiophron_PNG MG926855 MG913703 Papua New Guinea MNHN
10_Yves_Leiophron_PNG MG926856 MG913704 Papua New Guinea MNHN
AB016_Peristenus_KS KJ591487 KJ591282 USA HIC
AB020_Peristenus_KY KJ591488 KJ591283 USA HIC
AB023_Peristenus_KS KJ591489 KJ591284 USA HIC
Euph_001_Euphorus_pallidistigma_SWE MG926857 MG913762 Sweden NHRS
Euph_017_Peristenus_JAP MG926858 MG913763 Japan NHRS
Euph_020_Peristenus_SWE MG926859 MG913705 MG913764 Sweden NHRS
Euph_083_Peristenus_HUN MG926860 MG913706 Hungary NHRS
Euph_162_Leiophron_apicalis_SWE MG926861 Sweden NHRS
JS01000238_Leiophron_fascipennis_SWE MG926862 MG913713 Sweden NHRS
JS01000242_Leiophron_SWE KJ591452 KJ591243 Sweden NHRS
JS01000267_Leiophron_FRGU MG926863 MG913707 French Guiana NHRS
JS01000499_Mama_mariae_RUS KJ591460 KJ591250 Russia ZIN
JS01000515_Euphoriana_dispar_RUS KJ591458 MG913708 Russia ZIN
JS01000538_Euphorus_duploclaviventris_SWE MG926864 Sweden NHRS
JS01000539_Euphorus_oblitus_SWE MG926865 Sweden NHRS
JS01000540_Leiophron_deficiens_SWE MG926866 MG913709 Sweden NHRS
JS01000542_Leiophron_reclinator_SWE MG926867 Sweden NHRS
JS01000547_ Leiophron _MAD MG926868 MG913710 Madagascar NHRS
JS01000552_Peristenus_SWE MG926869 MG913711 MG913765 Sweden NHRS
JS01000553_Euphorus_basalis_SWE MG926870 MG913766 Sweden NHRS
JS01000554_Euphorus_fulvipes_SWE MG926871 MG913712 MG913767 Sweden NHRS
JS068_Leiophron_COL KJ591455 KJ591246 KJ591362 Colombia HIC
JS120_Leiophron_THA KJ591456 KJ591247 KJ591363 Thailand HIC
JS129_Leiophron_THA KJ591457 KJ591248 KJ591364 Thailand HIC
PNG_5_Leiophron MG926872 MG913714 Papua New Guinea MNHN
PNG_6_Leiophron MG926873 MG913715 Papua New Guinea MNHN
PNG_7_Leiophron MG926874 MG913716 Papua New Guinea MNHN
YMZ038_Peristenus_GER MG926875 MG913717 MG913768 Germany UCFC
YMZ077_Leiophron_uniformis_MB MG913718 MG913769 Canada UCFC
YMZ081_Euphoriella_MB MG926876 MG913719 MG913770 Canada UCFC
YMZ124_Peristenus_mellipes_MB KY566090 MG913720 MG913771 Canada UCFC
YMZ132_Leiophron_KY MG926877 MG913721 MG913772 USA UCFC
YMZ133_Leiophron_KY MG926878 MG913722 MG913773 USA UCFC
YMZ134_Leiophron_WV MG926879 MG913723 MG913774 USA UCFC
YMZ136_Leiophron_KY MG926880 MG913724 MG913775 USA UCFC
YMZ139_Leiophron_uniformis_FRA MG926881 MG913725 France UCFC
YMZ141_Leiophron_THA MG926882 MG913726 MG913776 Thailand UCFC
YMZ142_Peristenus_MAD MG926883 MG913727 Madagascar UCFC
YMZ145_Leiophron_COL MG926884 MG913728 MG913777 Colombia UCFC
YMZ146_Leiophron_COL MG926885 MG913729 Colombia UCFC
YMZ148_Euphoriella_GUA MG926886 MG913730 MG913778 Guatemala UCFC
YMZ211_Peristenus_dayi_MB KY566098 MG913731 MG913779 Canada UCFC
YMZ335_Peristenus_howardi_AB KY566100 MG913732 MG913780 Canada UCFC
YMZ341_Peristenus_relictus KY566106 MG913733 MG913781 USA UCFC
YMZ343_Peristenus_digoneuti MG926887 MG913734 MG913782 USA UCFC
YMZ345_Leiophron_KY MG926888 MG913735 USA UCFC
YMZ346_Peristenus_WI MG926889 MG913736 USA UCFC
YMZ349_Peristenus_IL MG926890 MG913738 USA UCFC
YMZ351_Leiophron_VA MG926891 MG913739 MG913783 USA UCFC
YMZ356_Peristenus_WI MG926892 MG913740 USA UCFC
YMZ358_Euphoriella_KY MG926893 MG913741 USA UCFC
YMZ359_Euphoriella_FL MG926894 MG913742 USA UCFC
YMZ361_Leiophron_AZ MG926895 MG913743 USA UCFC
YMZ363_Euphoriella_COL MG926896 MG913744 MG913784 Colombia UCFC
YMZ364_ Leiophron _CR MG926897 MG913745 Costa Rica UCFC
YMZ365_Euphoriella_CR MG926898 MG913746 Costa Rica UCFC
YMZ366_Euphoriella_GUA MG926899 MG913747 MG913785 Guatemala UCFC
YMZ367_Leiophron_HON MG926900 MG913748 Honduras UCFC
YMZ368_Leiophron_VEN MG926901 MG913749 Venezuela UCFC
YMZ370_Euphoriella_PER MG926902 MG913750 Peru UCFC
YMZ371_Leiophron_PER MG926903 MG913751 MG913786 Peru UCFC
YMZ372_Peristenus_PER MG926904 MG913752 Peru UCFC
YMZ373_Leiophron_THA MG926905 MG913787 Thailand UCFC
YMZ375_Leiophron_KEN MG926906 Kenya UCFC
YMZ376_Leiophron_THA MG926907 MG914753 Thailand UCFC
YMZ377_Leiophron_THA MG926908 MG914754 MG913788 Thailand UCFC
YMZ378_Leiophron_THA MG926909 MG914755 MG913789 Thailand UCFC
YMZ380_Leiophron_CON MG926910 MG914756 MG913790 Congo UCFC
YMZ382_Leiophron_KOR MG926911 MG913791 South Korea UCFC
YMZ383_Leiophron_KOR MG926912 MG913792 South Korea UCFC
YMZ384_Leiophron_KOR MG926913 MG914757 South Korea UCFC
YMZ385_Leiophron_KOR MG926914 MG914758 South Korea UCFC
YMZ386_Leiophron_CON MG926915 MG914759 Congo UCFC
YMZ388_Leiophron_pallidistigma_KOR MG926916 MG914760 South Korea UCFC
AB102 Microctonus (Perilitini) KJ591529 KJ591329 KJ591412 USA HIC
JS01000218 Townesilitus (Townesilitini) KJ591440 KJ591228 KJ591353 Sweden HIC
JS115 Chrysopophthorus (Helorimorphini) MG926854 MG913702 Colombia HIC
DOI: 10.7717/peerj.4783/table-1
Geographical distribution of specimens used in this study.

Figure 1: Geographical distribution of specimens used in this study.

Blue dots are published data from Stigenberg, Boring & Ronquist (2015), red dots are newly sampled taxa for this study.

Terminology and image capture

Terminology used for most morphological characters follows Chen & Van Achterberg (1997) and Stigenberg, Boring & Ronquist (2015). However, wing venation terminology follows Sharkey & Wharton (1997). Specimens were photographed using a Canon 7D Mark II with a Mitutoyo M Plan Apo 10× objective mounted onto the Canon EF Telephoto 70–200 mm zoom lens, and the Canon MT–24EX Macro Twin Lite Flash (Tokyo, Japan) with custom-made diffusers to minimize hot spots.

DNA protocols

A total of 80 taxa were sampled out of which three species represented outgroups. The taxon sampling covers the entire range of Euphorini, which is found on all continents except in Antarctica and Australia outside of Papua New Guinea (Yu, Van Achterberg & Horstmann, 2012). This is the largest sampling of any of the euphorine tribes, and is comprised of all three Euphorini genera, as well as all four subgenera of Leiophron s.l. Specimens were extracted, amplified, and sequenced either at the Molecular Systematics Laboratory, Swedish Museum of Natural History following the protocols listed in (Stigenberg, Boring & Ronquist, 2015), or at the Insect Systematics Laboratory at the University of Central Florida following the DNeasy™ Tissue Kit protocol (Qiagen, Valencia, CA, USA). Petioles were separated from mesosomas to ensure buffer penetration during tissue lysis, and the two body parts were mounted onto the same point post-extraction for vouchering. Voucher specimens deposition are listed in Table 1. Three genes were amplified: partial 28S domain 2 and 3 (rDNA), partial CAD (Carbamoyl-Phosphate Synthetase 2, Aspartate Transcarbamylase, and Dihydroorotase) and the 5′ region of mitochondrial COI. New Euphorini-specific primers were designed for CAD based on sequences from Sharanowski, Dowling & Sharkey (2011) and Stigenberg, Boring & Ronquist (2015). The faster rate of evolution of the mitochondrial genes is ideal for separating closely related species (Zhang, Ridenbaugh & Sharanowski, 2017), while the ribosomal and nuclear genes have slower rates of evolution and are more suitable for higher level phylogenetic relationships (Sharanowski, Dowling & Sharkey, 2011). All three genes are commonly used in Braconidae phylogenetics, including Euphorinae (Sharanowski, Dowling & Sharkey, 2011; Stigenberg, Boring & Ronquist, 2015; Zhang, Ridenbaugh & Sharanowski, 2017).

All PCRs were performed on a Bio-Rad MyCyclerTM thermal cycler, using approximately 1µg DNA extract, 1 × Standard Taq Buffer (10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl2, pH 8.3, New England Biolabs, Ipswich, Massachusetts, USA), 200 μM dNTP (Invitrogen, Carlsbad, CA, USA), 4 mM MgSO4, 400 nM of each primer, 1 unit of Taq DNA polymerase (New England Biolabs), and purified water to a final volume of 25 µl. Primer information and PCR conditions are listed in Table 2. Amplicons of reaction products were cleaned with Agencourt CleanSEQ magnetic beads and sequenced in both directions using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, USA) and the Applied Biosystems 3730xl DNA Analyzer at the University of Kentucky, Advanced Genetic Technologies Center (UK-AGTC). Contigs were assembled and edited using Geneious version 8.18 (Kearse et al., 2012), and alignment was conducted using MAFFT server (Katoh et al., 2002) (https://mafft.cbrc.jp/alignment/server/). The protein coding genes were aligned using default MAFFT settings, and for 28S we used Q-INS-I strategy (Katoh & Toh, 2008) which takes secondary RNA structure into account. New sequences obtained from this study were deposited in GenBank (See Table 1).

Table 2:
Primers.
List of primers used in this study.
Gene region Primers Sequence (5′ to 3′) Source Annealing temperature
28S D2F (fwd) AGTCGTGTTGCTTGATAGTGCAG Campbell, Steffen-Campbell & Werren (1994) 55 °C
D2R (rev) TTGGTCCGTGTTTCAAGACGGG Campbell, Steffen-Campbell & Werren (1994) 55 °C
COI LCO1490 (fwd) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) 49 °C
HCO2198 (rev) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) 49 °C
CAD CAD2F (fwd) TAYGAGCTTACCAAAATWGAYC New primer 52 °C
CAD2R (rev) CATAAATGTCCATCACAACTTC New primer 52 °C
DOI: 10.7717/peerj.4783/table-2

Phylogenetic analyses

The three genes were analyzed separately and concatenated using Bayesian inference (BI) analysis with MrBayes v3.2.6 (Ronquist et al., 2012) on the CIPRES Science Gateway (Miller et al., 2009). Each analysis had two independent searches with four chains and were run for 10,000,000 generations, sampling every 1,000, with a 10% burnin discarded. For the concatenated analysis, partitions were separated by gene and codon position for protein-coding genes for a total of six preselected partitions. Six partitions (28S; CAD_1; CAD_2 +CAD_3; COI_1; COI_2; and COI_3) were chosen using PartitionFinder 2.1.1 (Lanfear et al., 2016), based on the greedy algorithm and Bayesian Information Criterion (Table 3). The same partitions were also used for a maximum likelihood (ML) analysis using the relatively new IQ-Tree method (Nguyen et al., 2014), with 1,000 ultrafast bootstraps developed by Hoang et al. (2018). The concatenated dataset was also analyzed with RAxML v8.2.0 (Stamatakis, 2006), using the GTR+ Γ model of nucleotide substitution and 1,000 nonparametric bootstraps. All alignment files and scripts files can be accessed on Figshare (https://figshare.com/articles/Concatenated_File/6160247). All resulting trees were visualized using FigTree v1.4.2 (Rambaut, 2012). Intraspecific distances between Mama mariae Belokobylskij and Leiophron reclinator (Ruthe) was calculated using MEGA v7.0.21 (Kumar, Stecher & Tamura, 2016) using the Kimura-2-parameter (K2P) model (Kimura, 1980).

Results

Here we present the most taxonomically comprehensive phylogeny of the euphorine braconid tribe Euphorini with all known genera and subgenera sampled. All genera and subgenera had multiple representatives except Euphoriana (only one exemplar included - E. dispar) and the monotypic Mama mariae. A total of 39 CAD, 71 28S, and 80 COI for a total of 190 sequences were used for the final analyses, 158 of which were newly generated for this study (Table 1). The summary statistics of all three genes can be found in Table 3. While we failed to amplify CAD sequences from some older specimens, the gene itself is informative (See Table 3) and should be used in other multilocus analyses of braconids. All the individual BI gene trees (Figs. S1S3), as well as the concatenated BI and ML (Figs. S4S6) analyses strongly supported the monophyly of the tribe Euphorini (1, 100, 100, for MrBayes posterior probability, RAxML bootstrap support, and IQ-Tree ultrafast bootstrap support, respectively) as well as the monophyly of the genera Peristenus (1, 95, 99) and Leiophron s.l. (1, 90, 90) (Fig. 2).

Table 3:
Marker information.
Markers, partitions schemes, and substitution models (Model) according to PartitionFinder2. Additional summary includes number of basepairs (#bp), number of variable sites (#var), number of parsimonious informative sites (#par), and the CG content (CG%).
Marker and partitions #bp #var #par CG% Model References
28S nuclear DNA
28S_123 592 263 179 43.3 GTR+G Tavaré (1986)
CAD nuclear DNA 507 185 121 36.0
CAD_1 169 133 96 26.5 HKY+I+G Hasegawa, Kishino & Yano (1985)
CAD_23 338 52 25 40.3 HKY+I+G Hasegawa, Kishino & Yano (1985)
COI mtDNA 660 360 296 28.4
COI_1 220 103 78 33.8 GTR+I+G Tavaré (1986)
COI_2 220 55 33 38.4 GTR+G Tavaré (1986)
COI_3 220 202 185 12.8 GTR+I+G Tavaré (1986)
DOI: 10.7717/peerj.4783/table-3
Concatenated gene tree for MrBayes, RAxML, and IQ-Tree.

Figure 2: Concatenated gene tree for MrBayes, RAxML, and IQ-Tree.

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support for all three analyses (≥0.98 posterior probability support for MrBayes; ≥90 for bootstrap support for RAxML; and ≥90 for ultrafast bootstrap support for IQ-Tree).

Mama mariae, the only species from the monotypic genus Mama, was not supported as a distinct genus and was instead recovered as a sister group of Leiophron reclinator (Fig. 2) with 0.8% divergence among COI intraspecific genetic distance.

The four subgenera of Leiophron s.l. (Leiophron s.s., Euphoriana, Euphoriella, Euphorus) were not supported as distinct clades within the monophyletic Leiophron s.l. in any of the phylogenetic analyses (Fig. 2, Figs. S1S5).

Discussion

Generic concepts of Peristenus and Leiophron s.l.

Our data supports the monophyly of Peristenus and Leiophron, corroborating the results of previous morphological studies (Loan, 1974a; Loan, 1974b; Shaw, 1985; Shaw, 1987; Chen & Van Achterberg, 1997). Additionally, with a much more focused taxon sampling we were able to delineate the finer relationships within the tribe Euphorini. Peristenus is largely uniform in morphology and exclusively attacks Miridae, while its sister taxon Leiophron is much more variable in both morphology and host breadth which likely has led to convergent morphology, and hence the subgeneric concepts and taxonomic confusion. Peristenus can be distinguished from Leiophron by the evenly setose 1st discal, basal, and subbasal cells in the forewing (Fig. 3A), and the 1st metasomal tergite, which is fused or touching basally (Fig. 4B).

Forewing.

Figure 3: Forewing.

(A) Forewing of Peristenus; arrowing pointing to marginal cell. (B) Forewing of Leiophron. Photos by JH Meyer.
Leiophron vs Peristenus.

Figure 4: Leiophron vs Peristenus.

(A) Frontal view of Leiophron reclinator (Mama mariae syn. n), arrow pointing to spiny scape of antennae. (B) Ventral view of Peristenus metasoma, arrow pointing to the partially fused petiole. Ventral view of Leiophron metasoma: (C) arrowing pointing to ventral petiole showing unfused sclerite at midline. (D) arrowing pointing to completely fused sclerite at midline of petiole. Photos by JH Meyer.

Representatives of all four subgenera of Leiophron s.l. defined by Stigenberg, Boring & Ronquist (2015): Euphoriana, Euphoriella, Euphorus, and Leiophron s.s., were included in this analysis. These subgeneric relationships were not supported in any of our analyses, as they failed to form monophyletic clades (Fig. 2). This is not surprising given the lack of consistent morphological characters as specimens often exhibit characteristics of different subgenera, leading to similar suggestions for synonymizations in the past (Muesebeck, 1936; Loan, 1974b; Shaw, 1985; Stigenberg, Boring & Ronquist, 2015). Morphological characters such as the presence or absence of the forewing vein (RS + M)a, hindwing vein cu-a, and complete occipital carina are all too variable to be used as defining characteristics (Chen & Van Achterberg, 1997; Stigenberg, Boring & Ronquist, 2015). These ambiguous distinguishing characters at the subgeneric level can easily lead to misidentification in ecological or applied studies. Euphoriella is morphologically unique based on the absence of radial cell, and the fusion of ventral side of petiole. However, this subgenus is rendered paraphyletic by Leiophron sp. YMZ364 and YMZ371. The type species of Euphoriella, Euphoriella incerta Ashmead, was originally collected from Florida (Muesebeck, 1936). However, the type specimen is too badly damaged to be compared with our equally damaged DNA voucher also collected from Florida to accurately confirm its identity. While there are no nomenclatural rules that requires subgenera to be monophyletic, we do not support paraphyly as these morphological similarities could be the result of convergent evolution and does not reflect evolutionary history. Therefore, based on our molecular evidence combined with the inconsistency of previously used morphological characters, we recommend treating Leiophron as a single genus without further subdivisions and synonymize the subgenera Euphoriana, Euphoriella, and Euphorus as junior synonyms of Leiophron. With this taxonomic update, Leiophron can be identified with the following combination of characters: 1st discal cell of the forewing is more setose than basal and subbasal cells (often glabrous) in Leiophron (Fig. 3B), but if not, then the ventral side of the 1st metasomal tergite (petiole) is not fused (Fig. 4C).

The exact age of the divergence between Peristenus and Leiophron is unknown, as the only known fossil record of Euphorini is a single specimen described as Euphorus indurescens Brues, found in Florissant, Colorado and dating back to Eocene at around 33.7–37 mya (Brues, 1910). In addition, both Leiophron and Peristenus have received little taxonomic attention outside of Europe, North America, and Asia (Loan, 1974a; Loan, 1974b; Chen & Van Achterberg, 1997; Belokobylskij, 2000b; Goulet & Mason, 2006; Stigenberg & Van Achterberg, 2016). We have included many undescribed species from Central and South America, Africa, and Papua New Guinea, which is unsurprising given the tremendous diversity of their major host Miridae. The first and second author are currently working on describing species from Papua New Guinea (J Stigenberg & YM Zhang, 2018, unpublished data), but a revision of the world Euphorini is needed.

Validity of the genus Mama

The validity of the enigmatic genus Mama, described based on a single species M. mariae from eastern Russia (Belokobylskij, 2000a), has been questioned before by Simbolotti, Villemant & Van Achterberg (2004). Both M. mariae and L. reclinator have long, compressed, and spiny scapes (Fig. 4A), but due to the poor condition of the L. reclinator lectotype no definitive conclusion was made (Simbolotti, Villemant & Van Achterberg, 2004). With the consistent placement of the two species as sister taxa with short branch lengths in all three genes (Figs. S1S3) and concatenated dataset (Fig. 2), and identical in morphology (the second author has examined the holotypes of M. mariae and L. reclinator), we synonymize M. mariae syn. n. as a junior synonym of L. reclinator, thus effectively dissolving the monotypic genus Mama syn. n. as a junior synonym of Leiophron. The distribution of L. reclinator likely spans across Eurasia, as specimens are found from eastern Russia to Sweden and the United Kingdom (Stigenberg & Van Achterberg, 2016).

Updated generic concepts of Euphorini

Tribe Euphorini Foerster 1862

Diagnosis. Maxillary palp with five segments; labial palp with two to three segments; eye bare; first metasomal tergite petiolate; ovipositor slender and short, hardly protruding beyond metasoma; tarsal claws simple; forewing with marginal cell almost always equal or smaller than stigma (Fig. 3A); vein 3RSb (if present) strongly bent; vein r short or absent; vein 2M desclerotized; vein (RS+M)b absent; length of vein m-cu (if present) shorter than length of vein 2RS (Figs. 3A3B).

Genus Peristenus Foerster 1862

Peristenus Foerster, 1862: 25; Shenefelt, 1969: 36 (as synonym of Leiophron Nees, 1818); (Shaw, 1985): 332. Type species (by original designation): Microctonus barbiger Wesmael, 1835 [= Leiophron pallipes Curtis, 1833].

Diagnosis. Antennal segments 16–33; labial palp with three segments; occipital carina complete or interrupted dorsally; notaulus well-defined, crenulate, posteriorly joining just before posterior margin of mesoscutum; forewing with marginal cell large, complete; basal, subbasal, and 1st discal cells of forewing similarly setose (Fig. 3A); veins (RS+M)a, 1m-cu, 2CUa, 2CUb of forewing fully developed (Fig. 3A); veins rs-m, 2-1A of forewing absent; vein M+CU of forewing unsclerotized; veins 1cu-a and 1-1A of hindwing fully present; first metasomal tergite widened apically, ventrally fused or touching basally (Fig. 4B); metasomal tergites behind first tergite smooth; second suture absent; second tergite with lateral fold; hypopygium medium-sized, densely setose; ovipositor sheath slender, short, and densely setose; ovipositor slender, distinctly curved downwards.

Biology. Koinobiont endoparasitoids of Miridae (Hemiptera). The early instar nymphs are parasitized and the mature parasite larva emerge from either the mature host nymphs or the adults.

Distribution. Cosmopolitan except for Antarctic, limited to Papua New Guinea in Australasia.

Genus Leiophron Nees, 1818

Leiophron Nees, 1818: 303; Shenefelt, 1969: 35; Shaw, 1985: 326. Type species (designated by Viereck, 1914): Leiophron apicalis Haliday, 1833.

Euphoriana Gahan, 1913: 433; Shenefelt, 1969: 33; Shaw, 1985: 326. Type species (by original designation): Euphoriana uniformis Gahan, 1913. Syn. by Loan, 1974b.

Euphoriella Ashmead, 1900: 116; Shenefelt, 1969: 34; Shaw, 1985: 323. Type species (by monotypy & original designation): Labeo incertus Ashmead, 1887. Syn. By Chen & Van Achterberg, 1997

Euphorus Nees, 1834: 360; Shenefelt, 1969: 35; Shaw, 1985: 326): Type species (by monotypy): Euphorus pallicornis Nees, 1834. Syn. by Muesebeck, 1958.

Mama Belokobylskij, 2000: 256; Stigenberg, Boring & Ronquist, 2015: 590. Type species (by monotypy & original desgination): Mama mariae Belokobylskij, 2000. Syn.n.

Diagnosis. Antennal segments 14–20; labial palp with two to three segments; occipital carina usually widely interrupted dorsally; notaulus usually absent; marginal cell of forewing small, incomplete, or absent; 1st discal cell of forewing often more setose than basal and subbasal cells (Fig. 3B); forewing vein 3SRb ending far beforewing apex; forewing vein (RS+M)a present or absent; forewing vein 2M present; forewing vein M+CU largely unsclerotized; forewing vein 1M usually thickened; forewing vein 1CUb sclerotized or unsclerotized; forewing veins 2CUa and 2CUb absent; hindwing vein cu-a partly present or absent; first metasomal tergite nearly parallel-sided or slightly widened apically, ventrally variable: largely open, separated by a split at the midline (Fig. 3C), largely touching, or entirely fused (Fig. 3D); second and third tergites without lateral fold and second metasomal suture absent; hypopygium small, straight ventrally and setose; ovipositor hardly visible, usually shorter than 0.25 times first tergite, slender and curved downwards.

Biology. Koinobiont endoparasitoids of nymphal Hemiptera (Miridae and Lygaeidae) and Psocodea (Psocidae). The early instar nymph of the host is parasitized and the mature larva emerges from the mature host nymph or adult.

Distribution. Cosmopolitan except for Antarctic, limited to Papua New Guinea in Australasia.

Conclusions

Using a multilocus phylogenetics approach and the most comprehensive taxon sampling of Euphorini to date, we were able to clarify the long standing taxonomic confusion within this tribe of economically important braconid wasps. The taxonomic uncertainty that has long impacted biological control studies of Euphorini is readily resolved with the revised generic concepts presented here, which reflects the strongly supported phylogenetic analyses, therefore providing clear distinguishing characters for the two genera Peristenus and Leiophron. With a phylogenetic framework to build upon, the next step should focus on the world revision of tribe Euphorini, with a strong alpha taxonomic component, as many of the species used in this study were undescribed or have an unknown biology.

Supplemental Information

Detailed collection locality information for all specimens used in this study

DOI: 10.7717/peerj.4783/supp-1

COI gene tree for MrBayes

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥0.98 posterior probability).

DOI: 10.7717/peerj.4783/supp-2

28S gene tree for MrBayes

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥0.98 posterior probability).

DOI: 10.7717/peerj.4783/supp-3

CAD gene tree for MrBayes

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥0.98 posterior probability).

DOI: 10.7717/peerj.4783/supp-4

Concatenated gene trees for MrBayes

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥0.98 posterior probability).

DOI: 10.7717/peerj.4783/supp-5

Concatenated gene trees for RAxML

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥90 for bootstrap support).

DOI: 10.7717/peerj.4783/supp-6

Concatenated gene trees for IQ-Tree

Peristenus is colored red, and Leiophron is colored in blue, with subgenera within Leiophron shown in different colors (Leiophron sensu stricto in blue, Euphorus in purple, Euphoriana in green, Euphoriella in orange, and Mama in brown). Asterisks indicate strong nodal support ( ≥90 for ultrafast bootstrap support).

DOI: 10.7717/peerj.4783/supp-7

Raw nexus file COI

DOI: 10.7717/peerj.4783/supp-8

Raw nexus file 28S

DOI: 10.7717/peerj.4783/supp-9

Raw nexus file CAD

DOI: 10.7717/peerj.4783/supp-10

Raw nexus file of all 3 genes

DOI: 10.7717/peerj.4783/supp-11

Raw phylip file of all 3 genes

DOI: 10.7717/peerj.4783/supp-12