1 Citation   Views   Downloads

Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom

View article
RT @NicoArceAraya: @PLANCTON_ANDINO @marce9462 @T13 Si quieres puedes revisar acá el estudio completo https://t.co/NF0KwRrUGP Saludos.
RT @endcomputed: Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation add…
23 days ago
RT @endcomputed: Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation add…
RT @endcomputed: Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation add…
RT @endcomputed: Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation add…
RT @endcomputed: Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation add…
Largest baleen whale mass mortality event in Chile hisory. Not one Scientist will address decaying Fukushima radiation adding to warming of the Pacific ocean https://t.co/VBLTAUgap1
RT @NicoArceAraya: @PLANCTON_ANDINO @marce9462 @T13 Si quieres puedes revisar acá el estudio completo https://t.co/NF0KwRrUGP Saludos.
@PLANCTON_ANDINO @marce9462 @T13 Si quieres puedes revisar acá el estudio completo https://t.co/NF0KwRrUGP Saludos.
74 days ago
Parent research article: https://t.co/brB3Nl8mc0
RT @chris_harrod: Massive whale kill in Chile (343!) likely associated with harmful algal bloom. https://t.co/kzyeRV4R3R
RT @chris_harrod: Massive whale kill in Chile (343!) likely associated with harmful algal bloom. https://t.co/kzyeRV4R3R
82 days ago
RT @chris_harrod: Massive whale kill in Chile (343!) likely associated with harmful algal bloom. https://t.co/kzyeRV4R3R
Massive whale kill in Chile (343!) likely associated with harmful algal bloom. https://t.co/kzyeRV4R3R
RT @FI_Conservation: #WhaleWednesday Death of over 343 sei whales off Chile in 2015 caused by a harmful algal bloom linked to El Niño https…
RT @FI_Conservation: #WhaleWednesday Death of over 343 sei whales off Chile in 2015 caused by a harmful algal bloom linked to El Niño https…
RT @FI_Conservation: #WhaleWednesday Death of over 343 sei whales off Chile in 2015 caused by a harmful algal bloom linked to El Niño https…
#WhaleWednesday Death of over 343 sei whales off Chile in 2015 caused by a harmful algal bloom linked to El Niño https://t.co/rA4SljLSd7
150 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/UuVH68JWIC https://t.co/1Lb22dzZRL
152 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/UuVH68slR4 https://t.co/1Wcwd0djXr
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
152 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/G7QHCOqeHI https://t.co/Acw16Pzxpq
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
153 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/adCVuDesPr https://t.co/taNxHUJPEf
153 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
153 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/xfBCYe1Vof https://t.co/4uxHFDiMvH
153 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
153 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/auKbLRbBNS https://t.co/fd6CglnO0r
155 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
155 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/V9Pm05jZjf https://t.co/0t54C2XZeV
155 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/rOzkwOm35W https://t.co/XwoFUSSF2w
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
156 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/UFyrU3iDZB https://t.co/rEzlkaYck8
El Niño-related red tide kills 300+ sei https://t.co/0RQZQauQtB via @thePeerJ
156 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/O6dohH5wJS https://t.co/59HTdF8r7z
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
157 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/BxT1uIiSRk https://t.co/HE8AgjRlTI
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
El Niño-related red tide kills 300+ sei https://t.co/yNfwvOyFZ6 via @thePeerJ
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
158 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/BxT1uIiSRk https://t.co/SCnCQCicGZ
New PeerJ Video Abstract on the largest baleen whale mass mortality event https://t.co/b7zy1VaQnV Full article: https://t.co/GAcIQel5gn https://t.co/jpBjwWMeYS
158 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/xfBCYe1Vof https://t.co/48uWlhFgA4
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
159 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/BxT1uIiSRk https://t.co/o6zIVs5fXZ
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
159 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
159 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
159 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/rV4ajAFBIs https://t.co/QImEfk5YkT
159 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
159 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/xfBCYe1Vof https://t.co/EnYeKpcvYF
160 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
160 days ago
RT @ScotMarineInst: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://…
160 days ago
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/lTW3vRvfR4 https://t.co/6oXlgGfRFv
RT @thePeerJ: ICYMI: Largest baleen whale mass mortality during strong El Niño is likely related to harmful toxic algal bloom https://t.co/…
RT @PlanktonExplore: https://t.co/5QoUh1We0G
Baleen #whale mass mortality during El Niño event likely related to toxic algal bloom (pdf) https://t.co/0RePwx5Owz {
https://t.co/5QoUh1We0G
170 days ago
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
170 days ago
RT @thePeerJ: ICYMI: Largest baleen whale mass mortality during strong El Niño is likely related to harmful toxic algal bloom https://t.co/…
ICYMI: Largest baleen whale mass mortality during strong El Niño is likely related to harmful toxic algal bloom https://t.co/LSMXtbVuPp https://t.co/NyQvmnTjaq
New paper: #Whale #cetacean mass mortality during #elnino linked to #toxicalgae #harmfulalgalbloom #psp #chile https://t.co/j0rJh8bu3L
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
172 days ago
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
RT @thePeerJ: Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W…
Largest baleen whale mass mortality during strong El Niño event is likely related to harmful toxic algal bloom https://t.co/W4znQACf8P https://t.co/y0Uc6Q2YWD
PEER-REVIEWED

Introduction

Although most populations of whales have been fully protected from industrial hunting for half a century, some were reduced to such low levels that recovery is still very slow (Baker & Clapham, 2004). Today, whales face additional threats, such as ship strikes, entanglement and by-catch, underwater noise, pollution and habitat loss (Clapham, Young & Brownell, 1999). Moreover, since ocean conditions directly influence quality and availability of the prey species of baleen whales, the effects of climate change will become a concern (Simmonds & Isaac, 2007).

Mass mortality events (MMEs) of marine mammals generally involve social species such as dolphins or sea lions, but are rare in baleen whales due to their less gregarious behavior (Perrin, Würsig & Thewissen, 2009). When MMEs have occurred in baleen whales, they have often extended over several months and large areas, involving mostly coastal whales (Table 1). In the Northeast Pacific, seven to eight times more gray whales (Eschrichtius robustus) washed ashore during the years 1999 and 2000 than is usual in such a time span. Of these, 106 died within a three-month period in Mexico (Gulland et al., 2005). In the course of 2012, 116 southern right whales (Eubalaena australis), mostly calves, washed ashore at their breeding ground in Valdés Peninsula, Argentina (Anonymous, 2015). During 2009, 46 humpback whales (Megaptera novaeangliae) stranded in Australia (Coughran, Gales & Smith, 2013) and 96 in Brazil during 2010, most of them calves and juveniles (Rowntree et al., 2013). Less frequent and much smaller in magnitude are sudden and locally restricted baleen whale mortalities. The largest of those involved 14 humpback whales, which died around Cape Cod during five weeks in Nov 1987 (Geraci et al., 1989) (Table 1). The causes of most MMEs have not been conclusively identified (Anonymous, 2015; Coughran, Gales & Smith, 2013; Gulland et al., 2005); however, paralytic shellfish poisoning (PSP) during harmful algal blooms (HABs) has been argued as one of the main likely causes (and this is also the case for other marine vertebrate mass mortalities; Geraci et al., 1989; Durbin et al., 2002; Doucette et al., 2006; Rowntree et al., 2013; Cook et al., 2015; D’Agostino et al., 2015; Wilson et al., 2015; Lefebvre et al., 2016).

Table 1:
Recorded mass mortality events of baleen whales (updated from Table 1 in Rowntree et al. (2013)).
Region/site Time span Species Number Age classes Cause of death Source
Caleta Buena/slight inlet, Southern Chile Nov/Dec 1977 Rorqual Four fresh, numerous skeletons Unknown M. Salas, 2015, personal communication
Cape Cod (USA) Five weeks (11/1987) Humpback 14 HAB (saxitoxin) Geraci et al. (1989)
Upper Gulf of California (Mexico) ? (1995) Fin, minke and bryde1 Eight Unknown Vidal & Gallo Reynoso (1996)
Eastern North East Pacific Throughout 1999 Gray 2832 Mostly adults Malnutrition? Gulland et al. (2005)
Eastern North East Pacific Throughout 2000 Gray 368 Mostly adults Malnutrition? Gulland et al. (2005)
Upper Gulf of California (Mexico) ? (2009) Unknown 10 Unknown Rowntree et al. (2013)
Australia Throughout 2009 Humpback 46 Mostly calves and juveniles Unknown Coughran, Gales & Smith (2013)
Brazil Throughout 2010 Humpback 96 Mostly calves and juveniles Unknown Rowntree et al. (2013)
Peninsula Valdés (Argentina) 2005–20113 Southern right 420 Mostly calves Unknown (HAB-related? Starvation? Kelp gull harassment?) D’Agostino et al. (2015); Wilson et al. (2015)
Puerto Edén area (Chile) Mar 2011 Sei and/or minke Three Unknown This paper
Estero Cono (Chile) Mar 2012 Sei and/or minke 15 Unknown R.M. Fischer, 2015, personal communication
Puerto Edén area (Chile) Jan 2014 Sei and/or minke Five Unknown C. Cristie, 2015, personal communication
Between 46 and 51°S, mainly Golfo de Penas (Chile) Feb to early Apr 20154 Probably all sei 343 All HAB This paper
Alaska/British Columbia (USA/Canada) May/Jun 2015 Fin, humpback, gray 38 Unknown (HAB?) NOAA (2015b)
DOI: 10.7717/peerj.3123/table-1

Notes:

In total, 400 cetaceans died, including eight baleen whales.
A total of 106 in Mexico during three months.
A total of 116 died during 2012.
A total of 271 died within one month.

Harmful algal blooms have an extended record in Southern Chile (particularly the genus Alexandrium with production of paralytic shellfish toxins (PSTs)). HABs have been of concern to fishermen and Patagonian communities since at least 1972, when the first mass intoxication was recorded (Suárez & Guzmán, 2005). Since then, the geographic region in which blooms have been detected has increased to over 1,000 km north–south extent (Molinet et al., 2003). HABs have also become more frequent, becoming annual events with blooms normally occurring in large areas during the summer and fall (Guzmán et al., 2002). Due to the danger posed by these toxins, the Chilean government funds a monitoring program with over 200 sampling stations throughout the Southern part of Chile, where phytoplankton and shellfish samples are obtained and later analyzed for the presence of microalgae and their toxins (PST, amnesic shellfish toxin (AST), diarrheic shellfish toxin (DST)) (Suárez & Guzmán, 2005). Unfortunately, mainly due to the difficulty accessing many sites, these biotoxin data are only available for a limited coastal area of Southern Chile.

Chilean Patagonia is a complex environment that hosts one of the largest and most extensive fjord regions, with a north–south extent of approximately 1,500 km (42°S–55°S), covering an area of over 240,000 km2 and with a coastline of more than 80,000 km, made up of numerous fjords, channels and islands. At the same time, this is one of the least scientifically understood marine regions of the world (Försterra, 2009; Försterra, Häussermann & Laudien, 2017). Precipitation can locally exceed 6,000 mm per year and the tidal range can exceed 7 m. The prevailing strong westerly winds make its exposed shores amongst the most wave-impacted in the world (Försterra, 2009). These factors are responsible for the inaccessibility of a large part of this region. Chilean Patagonia is subdivided into the North, Central and South Patagonian zone (for a summary of biogeography of the region see Häussermann & Försterra, 2005 and Försterra, Häussermann & Laudien, 2017). The remote area around Golfo de Penas and Taitao Peninsula (Fig. 1) is situated in the Central Patagonian Zone between 47°S and 48°S. Except for two Chilean Navy lighthouses at Cabo Raper and San Pedro, the closest human settlements are more than 200 km away (Tortel, Puerto Aysén and Puerto Edén).

Location of dead whales and skulls found in Chilean Patagonian.

Figure 1: Location of dead whales and skulls found in Chilean Patagonian.

Boat track: green (HF24), flight track: blue (HF25). (A) Golfo de Penas, (B) Golfo Tres Montes and (C) Seno Escondido.

In general, Chilean Patagonia is influenced by the West Wind Drift, a large-scale eastward (onshore) flow which diverges at the coast to form the northward Humboldt Current and the southward Cape Horn Current (Thiel et al., 2007). The fjordic nature of the coastline produces significant local complexity, with many inlets and dispersed freshwater sources. High productivity in these coastal waters (Fig. 2) is driven by the availability of both terrestrial nutrients, carried by large rivers originating at the Northern and Southern Patagonian Ice Fields, and marine nutrients (González et al., 2010; Torres et al., 2014). While this region experiences coastal winds that favor net coastal downwelling, intermittent and/or localized upwelling, in particular in summer and North of Taitao Peninsula (47°S), is expected to enhance the supply of marine nutrients to coastal waters, and the relative balance between upwelling and downwelling varies from year to year.

Satellite image (MODIS Aqua) showing the concentration of chlorophyll a on Mar 23, 2015.

Figure 2: Satellite image (MODIS Aqua) showing the concentration of chlorophyll a on Mar 23, 2015.

Areas where most whales were found are circled.

During a vessel-based scuba diving expedition, “Huinay Fiordos 24” (HF24), focused on benthic fauna between Golfo Tres Montes (Northern Golfo de Penas, 46°30′W) and Puerto Eden (49°S), dead baleen whales and skeletal remains were discovered south of Golfo de Penas and at Golfo Tres Montes. Here, we describe by far the largest ever-recorded MME of baleen whales at one time and place. Our analyses focus on the location and cause of the mortality.

Materials and Methods

Field surveys

The vessel-based HF24 scuba diving expedition, from Apr 15 to May 8, 2015, aimed to inventory the benthic fauna of the area between Golfo Tres Montes (Northern Golfo de Penas, 46°30′W) and Puerto Edén (49°S). By chance, VH and her team discovered recently dead baleen whales and skeletal remains in and close to the entrance of the 14 km long Estero Slight and in the Canal Castillo situated 235 km to the south (Figs. 1 and 3; Table 2). Georeferences and photographs of different views were taken, whales measured, and species and sex identified whenever possible. Between May 25 and 31, the Chilean Fisheries Service (SERNAPESCA), with the support of the Chilean Navy (Armada) and the Criminal Investigation Department of the Civil Police (PDI), organized a vessel-based trip to the location of the dead whales in Estero Slight to investigate possible anthropogenic reasons behind the mortality. During this trip, genetic samples for species identification were taken, one ear bone was extracted and stomach and intestine contents of two whales were tested for presence of PST and AST (Fiscalía de Aysén, 2015). During a subsequent aerial survey, on-board a high wing airplane Cessna 206, between Jun 23 and 27, 2015, three of us (CG, VH and FH) surveyed the coasts along the shores of Golfo de Penas. This aerial survey covered the coastal area between the Jungfrauen Islands (48°S) and Seno Newman (46°39′S) from altitudes between 100 and 850 m and at speeds between 100 and 200 km/h (Figs. 1 and 4; Table 2). Due to limited flying time (unstable weather conditions and the inability to refuel in the area), data collection was focused on counting whale carcasses, recording GPS positions and taking photographs. A GoPro camera filmed continuously until reaching Seno Newman. The researchers on the flight counted carcasses and marked their coordinates while an audio recorder captured the carcass number, position, orientation, photo number, photographer and geomorphology of the beach. Whale counts were repeated in all areas except Seno Newman due to adverse weather conditions. Since there are no landing opportunities in this remote and unpopulated area, it was not possible to take samples or close-up photos, or to search for additional whale bones.

Documented whale carcasses and skeletal remains during a vessel survey in Apr 21, 2015 in Caleta Buena, Estero Slight.

Figure 3: Documented whale carcasses and skeletal remains during a vessel survey in Apr 21, 2015 in Caleta Buena, Estero Slight.

(A and B) Skeletal remains. (C) Recently dead sei whale. Photos: Keri-Lee Pashuk, all rights reserved.
Table 2:
List of whale carcasses, their degree of decomposition/disarticulation, location and date of finding.
Date Locality Whale ID Latitude Longitude State of decomposition Time at sea Carcass position Beach type Species Sex
HF24 expedition
Apr 21, 2015 West of Isla Centro 1 46°43.158′S 75°22.09′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 21, 2015 West of Isla Centro 2 46°43.069′S 75°22.553′W 1 Lateral-up Rocky Balaenoptera borealis Male
Apr 21, 2015 West of Isla Centro 3 46°43.095′S 75°22.759′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 21, 2015 West of Isla Centro 4 46°43.561′S 75°26.079′W 1 Rocky Balaenopteridae
Apr 21, 2015 Caleta Buena 5 46°46.92′S 75°30.057′W 1 Ventral-up Floating Balaenoptera borealis Female
Apr 21, 2015 Caleta Buena 6 46°47.25′S 75°29.872′W 1 Lateral-up Floating Balaenoptera borealis Male
Apr 21, 2015 Caleta Buena 7 46°47.248′S 75°29.876′W 1 Ventral-up Floating
Apr 21, 2015 Caleta Buena 8 46°47.275′S 75°29.837′W 1 Lateral-up Rocky Balaenoptera borealis Male
Apr 21, 2015 Caleta Buena 9 46°47.268′S 75°29.82′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 21, 2015 Caleta Buena 10 46°47.264′S 75°29.807′W 1 Lateral-up Rocky Balaenoptera borealis Female
Apr 21, 2015 Caleta Buena 11 46°47.261′S 75°29.798′W 1 Lateral-up Rocky Balaenoptera borealis Female
Apr 21, 2015 Caleta Buena 12 46°47.253′S 75°29.789′W 1 Lateral-up Rocky Balaenoptera borealis Male
Apr 21, 2015 Caleta Buena 13 46°47.249′S 75°29.787′W 3 Ventral-up Rocky
Apr 21, 2015 Caleta Buena 14 46°47.258′S 75°29.8′W 3 Ventral-up Floating
Apr 21, 2015 Caleta Buena 15 46°47.261′S 75°29.812′W 3 Ventral-up Floating
Apr 22, 2015 Estero Slight 16 46°47.135′S 75°32.269′W 2 Lateral-up Rocky Balaenoptera borealis
Apr 22, 2015 Estero Slight 17 46°47.214′S 75°34.332′W 3 Ventral-up Rocky
Apr 22, 2015 Estero Slight 18 46°47.817′S 75°32.788′W 1 Lateral-up Rocky Balaenoptera borealis Female
Apr 22, 2015 Estero Slight 19 46°47.951′S 75°32.973′W 2 Floating Balaenoptera borealis
Apr 22, 2015 Estero Slight 20 46°48.023′S 75°33.055′W 2 Rocky Balaenoptera borealis
Apr 22, 2015 Estero Slight 21 46°48.264′S 75°33.425′W 2 Ventral-up Rocky Balaenoptera borealis Female
Apr 22, 2015 Estero Slight 22 46°48.51′S 75°33.909′W 1 Lateral-up Rocky Balaenoptera borealis Female
Apr 22, 2015 Estero Slight 23 46°48.508′S 75°33.914′W 1 Lateral-up Rocky Balaenoptera borealis Male
Apr 22, 2015 Estero Slight 24 46°48.515′S 75°34.668′W 1 Lateral-up Sandy Balaenopteridae
Apr 22, 2015 Estero Slight 25 46°48.511′S 75°34.684′W 3 Dorsal up Sandy Balaenoptera borealis Female
Apr 22, 2015 Estero Slight 26 46°48.206′S 75°34.905′W 3 Ventral-up Rocky
Apr 22, 2015 Estero Slight 27 46°48.204′S 75°34.909′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 22, 2015 Estero Slight 28 46°48.09′S 75°34.9′W 3 Ventral-up Rocky
Apr 22, 2015 Estero Slight 29 46°48.01′S 75°34.909′W 3 Lateral-up Rocky
Apr 22, 2015 Estero Slight 30 46°48.008′S 75°34.902′W 3 Lateral-up Rocky
Apr 22, 2015 Estero Slight 31 46°47.919′S 75°34.86′W 1 Lateral-up Floating Balaenoptera borealis Female
Apr 22, 2015 Estero Slight 32 46°47.642′S 75°34.753′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 22, 2015 Estero Slight 33 46°47.538′S 75°34.651′W 1 Lateral-up Rocky Balaenopteridae
Apr 22, 2015 Estero Slight 34 46°47.442′S 75°34.463′W 3 Lateral-up Rocky
Apr 22, 2015 Estero Slight 35 46°46.173′S 75°33.247′W 1 Ventral-up Rocky Balaenoptera borealis Male
Apr 22, 2015 Estero Slight 36 48°46.002′S 75°33.066′W 3 Ventral-up Rocky
Apr 22, 2015 Estero Slight/Baja Julio 37 48°45.626′S 75°31.102′W 2 Floating
Apr 22, 2015 Estero Slight/Baja Julio 38 48°45.530′S 75°30.962′W 1 Lateral-up Rocky Balaenopteridae
Apr 22, 2015 Estero Slight/Baja Julio 39 46°45.205′S 75°30.75′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 22, 2015 Estero Slight/Baja Julio 40 46°45.008′S 75°30.674′W 1 Lateral-up Rocky Balaenoptera borealis
Apr 22, 2015 Islote Amarillo 41 46°40.967′S 75°27.983′W 1 Lateral-up Rocky Balaenopteridae
Apr 22, 2015 Islote Amarillo 42 46°40.722′S 75°27.21′W 1 Lateral-up Rocky Balaenopteridae
Apr 22, 2015 Isla Esmeralda 43 48°48.08′S 75°24.29′W
Apr 22, 2015 Isla Hyatt 44 48°47.95′S 75°26.45′W
Apr 22, 2015 Isla Hyatt 45 48°47.3′S 75°26.13′W
Apr 22, 2015 Isla Hyatt 46 48°47.26′S 75°26.01′W
Apr 22, 2015 Isla Hyatt 47 48°47.19′S 75°25.91′W
HF25 expedition
Jun 23, 2015 Jungfrauen group 48 47°32.29′S 74°32.484′W 2 2 Lateral-up Rocky
Jun 23, 2015 Jungfrauen group 49 47°36.16′S 74°34.997′W Floating
Jun 24, 2015 Jungfrauen group 50 48°3.874′S 75°1.788′W Floating Balaenopteridae
Jun 24, 2015 Jungfrauen group 51 48°3.875′S 75°1.791′W Floating Balaenopteridae
Jun 24, 2015 Jungfrauen group 52 48°4.209′S 75°1.052′W Rocky
Jun 24, 2015 Jungfrauen group 53 48°3.361′S 75°7.514′W Rocky
Jun 24, 2015 Jungfrauen group 54 47°59.048′S 75°15.302′W 2 2 Lateral-up Rocky
Jun 24, 2015 Jungfrauen group 55 47°57.402′S 75°15.671′W 2 2 Rocky
Jun 24, 2015 Jungfrauen group 56 47°57.554′S 75°14.56′W 2 1 Rocky
Jun 24, 2015 Jungfrauen group 57 47°56.28′S 75°14.706′W 2 1 Rocky
Jun 24, 2015 Jungfrauen group 58 47°51.025′S 75°13.345′W 1 1 Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 59 47°50.923′S 75°12.912′W 1 1 Rocky
Jun 24, 2015 Jungfrauen group 60 47°50.701′S 75°12.218′W 2 1 Lateral-up Rocky
Jun 24, 2015 Jungfrauen group 61 47°50.799′S 75°13.279′W 2 1 Ventral-up Rocky
Jun 24, 2015 Jungfrauen group 62 47°48.885′S 75°12.317′W 2 Sandy
Jun 24, 2015 Jungfrauen group 63 47°48.598′S 75°12.183′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Jungfrauen group 64 47°52.994′S 75°11.915′W Rocky
Jun 24, 2015 Jungfrauen group 65 47°52.766′S 75°11.704′W Rocky
Jun 24, 2015 Jungfrauen group 66 47°53.019′S 75°9.343′W 2 Rocky
Jun 24, 2015 Jungfrauen group 67 47°53.004′S 75°9.316′W 2 1 Rocky
Jun 24, 2015 Jungfrauen group 68 47°52.409′S 75°8.578′W Sandy Balaenopteridae
Jun 24, 2015 Jungfrauen group 69 47°51.775′S 75°4.472′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 70 47°51.527′S 75°3.374′W Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 71 47°49.123′S 75°3.696′W 2 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 72 47°49.698′S 75°59.956′W Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 73 47°47.558′S 74°58.11′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 74 47°47.474′S 74°58.107′W 2 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Jungfrauen group 75 47°47.089′S 74°58.445′W Rocky
Jun 24, 2015 Jungfrauen group 76 47°17.614′S 74°22.75′W Sandy
Jun 24, 2015 Jungfrauen group 77 47°17.454′S 74°22.494′W Sandy
Jun 24, 2015 San Quintin bay I 78 46°50.51′S 74°37.41′W Sandy
Jun 24, 2015 San Quintin bay I 79 46°49.324′S 74°35.952′W Sandy
Jun 24, 2015 San Quintin bay I 80 46°49.905′S 74°36.359′W Lateral-up Sandy Balaenoptera borealis
Jun 24, 2015 San Quintin bay I 81 46°49.973′S 74°36.381′W Lateral-up Sandy Balaenoptera borealis
Jun 24, 2015 San Quintin bay I 82 46°50.495′S 74°36.442′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 83 46°50.488′S 74°36.428′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 84 46°50.476′S 74°36.304′W Ventral-up Sandy–rocky
Jun 24, 2015 San Quintin bay I 85 46°50.474′S 74°36.288′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 86 46°50.476′S 74°36.262′W 1 1 Ventral-up Sandy–rocky
Jun 24, 2015 San Quintin bay I 87 46°50.47′S 74°36.128′W 2 Lateral-up rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 88 46°50.467′S 74°36.104′W 1 1 Lateral-up rocky
Jun 24, 2015 San Quintin bay I 89 46°50.444′S 74°36.02′W 2 1 Lateral-up Sandy–rocky
Jun 24, 2015 San Quintin bay I 90 46°50.437′S 74°35.943′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 91 46°50.431′S 74°35.931′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 92 46°50.428′S 74°35.925′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 93 46°50.422′S 74°35.926′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 94 46°50.405′S 74°35.924′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 95 46°50.404′S 74°35.921′W 1 1 Lateral-up Sandy
Jun 24, 2015 San Quintin bay I 96 46°50.371′S 74°35.951′W 2 1 Lateral-up Sandy
Jun 24, 2015 San Quintin bay I 97 46°50.357′S 74°35.96′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 98 46°50.355′S 74°35.957′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 99 46°50.353′S 74°35.96′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 100 46°50.326′S 74°36.22′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 101 46°50.322′S 74°36.024′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 102 46°50.285′S 74°36.188′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay I 103 46°50.256′S 74°36.102′W 1 1 Rocky
Jun 24, 2015 San Quintin bay I 104 46°50.254′S 74°36.094′W 2 1 Rocky
Jun 24, 2015 San Quintin bay I 105 46°50.23′S 74°36.073′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 106 46°50.1′S 74°36.194′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 107 46°50.243′S 74°35.836′W 2 1 Ventral-up Sandy
Jun 24, 2015 San Quintin bay I 108 46°50.247′S 74°35.834′W 2 1 Ventral-up Sandy
Jun 24, 2015 San Quintin bay I 109 46°50.251′S 74°35.652′W 3 1 Ventral-up Sandy
Jun 24, 2015 San Quintin bay I 110 46°50.258′S 74°35.639′W 2 1 Ventral-up Sandy
Jun 24, 2015 San Quintin bay I 111 46°50.212′S 74°35.585′W 1 1 Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 112 46°50.229′S 74°35.513′W 2 1 Lateral-up Sandy–rocky
Jun 24, 2015 San Quintin bay I 113 46°50.222′S 74°35.483′W 2 Rocky
Jun 24, 2015 San Quintin bay I 114 46°50.214′S 74°35.429′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 115 46°50.195′S 74°35.315′W 1 1 Ventral-up Rocky
Jun 24, 2015 San Quintin bay I 116 46°50.184′S 74°35.18′W Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 San Quintin bay I 117 46°50.172′S 74°35.1′W 2 1 Ventral-up Rocky
Jun 24, 2015 San Quintin bay I 118 46°50.126′S 74°34.995′W 2 1 Sandy–rocky
Jun 24, 2015 San Quintin bay I 119 46°50.122′S 74°34.894′W Sandy–rocky
Jun 24, 2015 San Quintin bay I 120 46°49.958′S 74°34.433′W Rocky
Jun 24, 2015 San Quintin bay I 121 46°49.928′S 74°34.459′W 2 1 Rocky
Jun 24, 2015 San Quintin bay I 122 46°49.902′S 74°34.385′W 2 Rocky
Jun 24, 2015 San Quintin bay I 123 46°49.879′S 74°34.158′W Ventral-up Sandy–rocky
Jun 24, 2015 San Quintin bay I 124 46°50.482′S 74°38.058′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 125 46°48.956′S 74°39.394′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 126 46°49.207′S 74°39.756′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 127 46°49.145′S 74°40.03′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 128 46°49.299′S 74°40.244′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 129 46°49.136′S 74°40.346′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 130 46°49.134′S 74°40.346′W Ventral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 131 46°49.117′S 74°40.317′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 132 46°49.12′S 74°40.324′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 133 46°48.872′S 74°40.634′W Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 134 46°49.026′S 74°40.594′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 135 46°49.017′S 74°40.617′W 1 1 Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 136 46°49.111′S 74°40.713′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 137 46°49.109′S 74°40.727′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 138 46°49.243′S 74°40.792′W 1 1 Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 139 46°49.218′S 74°40.821′W Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 140 46°49.182′S 74°40.863′W 1 Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 141 46°49.185′S 74°40.893′W 1 1 Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 142 46°49.155′S 74°41.014′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 143 46°49.146′S 74°41.118′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 144 46°48.985′S 74°41.307′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 145 46°49.003′S 74°41.312′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 146 46°49.008′S 74°41.313′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 147 46°49.028′S 74°41.327′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 148 46°49.061′S 74°41.359′W Rocky
Jun 24, 2015 San Quintin bay II 149 46°49.104′S 74°41.404′W Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 150 46°49.027′S 74°41.441′W Rocky Balaenopteridae
Jun 24, 2015 San Quintin bay II 151 46°48.909′S 74°41.55′W Floating
Jun 24, 2015 San Quintin bay II 152 46°48.87′S 74°41.539′W Floating Balaenopteridae
Jun 24, 2015 San Quintin bay II 153 46°48.645′S 74°41.697′W Sandy
Jun 24, 2015 San Quintin bay II 154 46°48.691′S 74°41.584′W Sandy
Jun 24, 2015 San Quintin bay II 155 46°46.879′S 74°46.086′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 San Quintin bay II 156 46°49.78′S 74°32.109′W Rocky
Jun 24, 2015 Seno Newman 157 46°43.813′S 74°57.964′W 2 2 Sandy
Jun 24, 2015 Seno Newman 158 46°41.327′S 75°0.753′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 159 46°37.458′S 75°2.434′W 2 Sandy–rocky
Jun 24, 2015 Seno Newman 160 46°37.415′S 75°2.637′W 1 1 Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 161 46°37.415′S 75°2.635′W 1 1 Sandy–rocky
Jun 24, 2015 Seno Newman 162 46°36.941′S 75°2.113′W 2 1 Sandy
Jun 24, 2015 Seno Newman 163 46°36.918′S 75°2.082′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 164 46°36.854′S 75°2.004′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 165 46°36.756′S 75°1.976′W Rocky
Jun 24, 2015 Seno Newman 166 46°36.539′S 75°1.71′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 167 46°36.441′S 75°2.075′W 1 1 Ventral-up Sandy
Jun 24, 2015 Seno Newman 168 46°36.369′S 75°1.672′W Floating
Jun 24, 2015 Seno Newman 169 46°35.82′S 75°1.375′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 170 46°35.377′S 75°1.041′W 1 1 Ventral-up Rocky
Jun 24, 2015 Seno Newman 171 46°35.161′S 75°0.66′W Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 172 46°35.087′S 75°0.513′W 1 Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 173 46°35.089′S 75°0.49′W 1 Sandy
Jun 24, 2015 Seno Newman 174 46°35.083′S 75°0.42′W 1 1 Floating Balaenopteridae
Jun 24, 2015 Seno Newman 175 46°35.085′S 74°59.71′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 176 46°34.88′S 74°59.475′W Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 177 46°34.794′S 74°59.426′W Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 178 46°34.449′S 74°59.313′W Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 179 46°33.721′S 74°59.271′W 2 Ventral-up Sandy
Jun 24, 2015 Seno Newman 180 46°33.501′S 74°59.192′W 2 1 Sandy–rocky
Jun 24, 2015 Seno Newman 181 46°33.125′S 74°58.681′W 2 Rocky
Jun 24, 2015 Seno Newman 182 46°33.12′S 74°58.674′W 1 1 Rocky
Jun 24, 2015 Seno Newman 183 46°32.939′S 74°58.52′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 184 46°32.521′S 74°57.707′W 2 Rocky
Jun 24, 2015 Seno Newman 185 46°32.473′S 74°57.635′W 2 1 Rocky
Jun 24, 2015 Seno Newman 186 46°32.424′S 74°57.582′W 2 1 Rocky
Jun 24, 2015 Seno Newman 187 46°32.388′S 74°57.532′W 2 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 188 46°32.346′S 74°57.469′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 189 46°32.348′S 74°57.469′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 190 46°32.267′S 74°57.188′W 2 1 Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 191 46°32.096′S 74°57.303′W 1 1 Sandy
Jun 24, 2015 Seno Newman 192 46°32.07′S 74°57.254′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 193 46°32.068′S 74°57.247′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 194 46°32.027′S 74°57.153′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 195 46°31.998′S 74°57.106′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 196 46°31.919′S 74°57.006′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 197 46°31.852′S 74°56.936′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 198 46°31.829′S 74°56.922′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 199 46°31.721′S 74°56.839′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 200 46°31.592′S 74°56.733′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 201 46°31.461′S 74°56.568′W 2 1 Lateral-up Sandy
Jun 24, 2015 Seno Newman 202 46°31.311′S 74°56.537′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 203 46°31.304′S 74°56.525′W 2 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 204 46°31.265′S 74°56.489′W 2 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 205 46°31.055′S 74°56.197′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 206 46°30.974′S 74°56.093′W 2 1 Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 207 46°30.948′S 74°56.065′W 2 1 Lateral-up Sandy–rocky
Jun 24, 2015 Seno Newman 208 46°30.866′S 74°55.959′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 209 46°30.859′S 74°55.953′W 2 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 210 46°30.824′S 74°55.907′W 2 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 211 46°30.757′S 74°55.817′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 212 46°30.702′S 74°55.734′W 1 1 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 213 46°30.709′S 74°55.689′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 214 46°30.707′S 74°55.674′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 215 46°30.662′S 74°55.593′W 3 Ventral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 216 46°30.624′S 74°55.439′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 217 46°30.627′S 74°55.432′W 2 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 218 46°30.629′S 74°55.425′W 2 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 219 46°30.632′S 74°55.419′W 2 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 220 46°30.63′S 74°55.411′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 221 46°30.627′S 74°55.368′W Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 222 46°30.618′S 74°55.338′W Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 223 46°30.191′S 74°55.327′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 224 46°30.093′S 74°55.297′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 225 46°30.054′S 74°55.243′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 226 46°29.992′S 74°55.167′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 227 46°29.984′S 74°55.165′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 228 46°29.975′S 74°55.164′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 229 46°29.925′S 74°55.167′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 230 46°29.895′S 74°55.166′W 2 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 231 46°29.742′S 74°55.164′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 232 46°29.329′S 74°55.094′W 1 1 Lateral-up Floating
Jun 24, 2015 Seno Newman 233 46°29.385′S 74°54.993′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 234 46°29.32′S 74°54.924′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 235 46°29.218′S 74°54.888′W 1 1 Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 236 46°29.137′S 74°54.821′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 237 46°29.131′S 74°54.818′W 2 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 238 46°29.124′S 74°54.813′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 239 46°29.106′S 74°54.809′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 240 46°29.086′S 74°54.803′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 241 46°29.066′S 74°54.813′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 242 46°28.991′S 74°54.825′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 243 46°28.911′S 74°54.822′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 244 46°28.887′S 74°54.826′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 245 46°28.812′S 74°54.831′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 246 46°28.761′S 74°54.83′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 247 46°28.705′S 74°54.828′W 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 248 46°28.658′S 74°54.828′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 249 46°28.654′S 74°54.831′W 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 250 46°28.645′S 74°54.83′W Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 251 46°28.637′S 74°54.831′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 252 46°28.521′S 74°54.913′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 253 46°27.411′S 74°54.979′W 1 1 Ventral-up Rocky
Jun 24, 2015 Seno Newman 254 46°27.365′S 74°54.984′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 255 46°27.314′S 74°54.988′W 1 1 Lateral-up Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 256 46°27.214′S 74°54.829′W Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 257 46°26.271′S 74°53.366′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 258 46°26.119′S 74°53.609′W Sandy
Jun 24, 2015 Seno Newman 259 46°26.111′S 74°53.714′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 260 46°26.123′S 74°53.747′W Lateral-up Floating Balaenopteridae
Jun 24, 2015 Seno Newman 261 46°26.116′S 74°53.771′W Lateral-up Floating Balaenopteridae
Jun 24, 2015 Seno Newman 262 46°26.264′S 74°54.143′W Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 263 46°26.336′S 74°54.127′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 264 46°26.352′S 74°54.148′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 265 46°26.34′S 74°54.321′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 266 46°26.335′S 74°54.394′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 267 46°26.656′S 74°55.481′W 2 1 Rocky
Jun 24, 2015 Seno Newman 268 46°26.797′S 74°55.902′W Rocky
Jun 24, 2015 Seno Newman 269 46°27.022′S 74°56.047′W 1 1 Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 270 46°27.248′S 74°56.114′W Rocky
Jun 24, 2015 Seno Newman 271 46°27.959′S 74°56.175′W Sandy–rocky
Jun 24, 2015 Seno Newman 272 46°28.193′S 74°56.104′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 273 46°28.253′S 74°56.094′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 274 46°28.385′S 74°56.166′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 275 46°28.405′S 74°56.161′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 276 46°28.461′S 74°56.144′W Sandy–rocky
Jun 24, 2015 Seno Newman 277 46°29.752′S 74°57.068′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 278 46°30.896′S 74°58.426′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 279 46°30.918′S 74°58.439′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 280 46°31.016′S 74°58.904′W Rocky
Jun 24, 2015 Seno Newman 281 46°31.284′S 74°59.402′W 1 1 Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 282 46°31.967′S 74°59.824′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 283 46°31.979′S 74°59.845′W 1 1 Lateral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 284 46°32.007′S 74°59.867′W 1 1 Ventral-up Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 285 46°31.638′S 75°0.132′W Rocky
Jun 24, 2015 Seno Newman 286 46°31.532′S 75°0.959′W Rocky
Jun 24, 2015 Seno Newman 287 46°31.767′S 75°0.989′W Rocky
Jun 24, 2015 Seno Newman 288 46°31.798′S 75°1.062′W Rocky
Jun 24, 2015 Seno Newman 289 46°32.125′S 75°0.925′W 1 1 Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 290 46°32.493′S 75°1.119′W 1 1 Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 291 46°32.689′S 75°1.12′W 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 292 46°33.363′S 75°1.351′W 2 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 293 46°33.372′S 75°1.344′W 1 1 Lateral-up Sandy Balaenopteridae
Jun 24, 2015 Seno Newman 294 46°33.428′S 75°1.334′W 1 Rocky Balaenopteridae
Jun 24, 2015 Seno Newman 295 46°33.958′S 75°1.688′W Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 296 46°33.966′S 75°1.732′W 1 1 Sandy–rocky
Jun 24, 2015 Seno Newman 297 46°33.977′S 75°1.746′W 2 1 Floating
Jun 24, 2015 Seno Newman 298 46°34.271′S 75°1.855′W 2 1 Rocky
Jun 24, 2015 Seno Newman 299 46°34.429′S 75°2.047′W 2 Rocky
Jun 24, 2015 Seno Newman 300 46°34.463′S 75°2.194′W Sandy–rocky
Jun 24, 2015 Seno Newman 301 46°38.102′S 75°8.96′W 1 1 Sandy
Jun 24, 2015 Seno Newman 302 46°38.089′S 75°9.632′W 1 Sandy–rocky
Jun 24, 2015 Seno Newman 303 46°39.046′S 75°12.857′W Sandy–rocky Balaenopteridae
Jun 24, 2015 Seno Newman 304 46°39.4′S 75°15.631′W Rocky
Jun 24, 2015 Seno Newman 305 46°42.092′S 75°14.267′W 1 1 Sandy–rocky Balaenopteridae
Other sources
Middle of March Bahía Conos 306 46°36.2′S 75°28.7′W 3
Middle of March Bahía Conos 307 46°36.229′S 75°28.664′W 3
Feb 21, 2015 Isla Crosslet 308 46°43.494′S 75°10.521′W 3
Feb 22, 2015 Isla Crosslet 309 46°45.32′S 75°11.175′W 1 Balaenopteridae
End of Feb 2015 Fiordo San Pablo 310 46°36.677′S 75°9.685′W 1 Balaenopteridae
End of Feb 2015 Fiordo San Pablo 311 46°36.271′S 75°9.471′W 3
End of Feb 2015 Estero Slight 312 46°43.26′S 75°9.37′W 1 Lateral-up Floating Balaenoptera borealis Female
End of Feb 2015 Estero Slight 313 46°43.26′S 75°9.37′W 1 Balaenopteridae
End of Feb 2015 Estero Slight 314 46°43.26′S 75°9.37′W 3
End of Feb 2015 Estero Slight 315 46°47.18′S 75°32.417′W 3
Middle of Mar 2015 Bahía Conos 316 46°37.007′S 75°27.578′W 1 Balaenopteridae
Middle of Mar 2015 Bahía Conos 317 46°37.084′S 75°27.664′W 1 Balaenopteridae
Middle of Mar 2015 Bahía Conos 318 46°37.011′S 75°27.788′W 1 Balaenopteridae
Middle of Mar 2015 Bahía Conos 319 46°36.918′S 75°27.726′W 1 Balaenopteridae
Middle of Mar 2015 Bahía Conos 320 46°36.893′S 75°27.881′W 1 Balaenopteridae
Middle of Mar 2015 Canal Barros Luco 321 50°9.450′S 75°17.317′W 1 Balaenopteridae
Middle of Mar 2015 Canal Ladrillero 322 49°8.000′S 75°17.000′W 1 Balaenopteridae
Middle of Mar 2015 South from Isla Solar 323 50°58.975′S 75°4.276′W 1 Balaenopteridae
Mar 23, 2015 Near Cape Stokes 324 46°54.558′S 75°14.109′W 1 Rocky Balaenopteridae
Mar 23, 2015 Near Cape Stokes 325 46°55.76′S 75°16.796′W 1 Sandy Balaenopteridae
Mar 23, 2015 Brazo Oeste–Barroso 326 46°50.91′S 75°15.332′W 1 Sandy Balaenopteridae
Mar 25, 2015 Brazo Este–Barroso 327 46°51.761′S 75°15.577′W 1 Balaenopteridae
Mar 5, 2015 Isla Hereford 328 46°43.26′S 75°9.37′W 1 Balaenopteridae
Mar 5, 2015 Isla Hereford 329 46°43.26′S 75°9.37′W 1 Balaenopteridae
Mar 5, 2015 Isla Hereford 330 46°43.26′S 75°9.37′W 3
Mar 5, 2015 Isla Hereford 331 46°35.925′S 75°11.636′W 2
May 14, 2015 Paso Isaza 332 50°53.983′S 74°18.133′W 1 Lateral-up Floating Balaenoptera borealis Male
Jul 5, 2015 Near Puerto Natales 333 49°35.733′S 74°26.083′W 1 Lateral-up Floating Balaenoptera borealis Female
Middle of May 2015 Near Puerto Natales 334 51°28.567′S 73°44.95′W 3
Middle of May 2015 Near Puerto Natales 335 51°28.392′S 73°44.941′W 3
Middle of May 2015 Near Puerto Natales 336 51°28.399′S 73°45.399′W 3
Middle of May 2015 Near Puerto Natales 337 51°28.519′S 73°45.078′W 3
probably December 2015 Canal Ladrillero 338 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 339 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 340 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 341 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 342 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 343 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 345 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 346 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 347 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 348 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 349 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 350 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 351 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 352 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 353 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 354 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 355 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 356 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 357 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 358 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 359 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 360 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 361 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 362 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 363 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 364 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 365 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 366 49°8.000′S 75°17.000′W
probably December 2015 Canal Ladrillero 367 49°8.000′S 75°17.000′W
HF26 expedition
Feb 4, 2016 Bayron 368 47°48.102′ S 74°58.235′W 1 1 Floating Balaenopteridae
Feb 6, 2016 Seno Escondido 369 46°50.885′S 74°27.675′W 1 1 Sandy–rocky Balaenopteridae
Feb 13, 2016 Seno Slight 370 46°42.880′S 75°28.803′W 1 1 Sandy–rocky Balaenopteridae
Feb 14, 2016 Seno Slight 371 46°48.525′S 75°34.157′W 1 1 Sandy–rocky Balaenopteridae
Feb 14, 2016 Seno Slight 372 46°47.800′S 75°32.773′W 1 1 Sandy–rocky Balaenopteridae
Feb 15, 2016 Seno Slight 373 46°47.272′S 75°29.853′W 1 1 Sandy–rocky Balaenopteridae
Feb 15, 2016 Seno Slight 374 46°46.232′S 75°31.137′W 1 1 Sandy–rocky Balaenopteridae
Feb 18, 2016 Newman 375 46°29.557′S 74°55.182′W 1 1 Sandy–rocky Balaenopteridae
Feb 22, 2016 Newman 376 46°30.672′S 74°55.607′W 1 1 Sandy–rocky Balaenopteridae
Feb 23, 2016 Caleta Buena 377 46°47.072′S 75°29.847′W 1 1 Sandy–rocky Balaenopteridae
Feb 23, 2016 Caleta Buena 378 46°47.233′S 75°29.843′W 1 1 Sandy–rocky Balaenopteridae
Feb 24, 2016 Slight 379 46°47.233′S 75°29.843′W 1 1 Sandy–rocky Balaenopteridae
Feb 24, 2016 Slight 380 46°48.413′S 75°34.772′W 1 1 Sandy–rocky Balaenopteridae
May 2016 Seno Escondido 381 46°49.963′S 74°39.016′W Floating
May 2016 Slight 382 46°47.444′S 74°34.460′W
May 2016 Newman 383 46°30.672′S 74°55.607′W
Other sources
Feb 6, 2016 Islas Jungfrauen 384 47°55.527′S 75°6.832′W
Mar 13, 2016 Ushuaia 385 54°53.756′S 67°22.571′W 1 1 Floating Megaptera novaeangliae
Mar 28, 2016 Navarino 386 54°55.350′S 68°18.555′W 2 1 Megaptera novaeangliae
Jan 2016 Canal Ladrillero 387 49°8.000′S 75°17.000′W Floating
Jan 2016 Canal Ladrillero 388 49°8.000′S 75°17.000′W Floating
DOI: 10.7717/peerj.3123/table-2
Documented whale carcasses and skeletal remains during an overflight on Jun 25, 2015, Seno Escondido.

Figure 4: Documented whale carcasses and skeletal remains during an overflight on Jun 25, 2015, Seno Escondido.

The numbers correspond to the whale identification numbers in Table 1. Photos: Verena Häussermann, all rights reserved.

In addition to the whale carcasses and skeletons from the two surveys, some whale carcasses and skulls were reported between Feb and Jun 2015 by boat crews navigating the west coast of Taitao Peninsula and the coast between 49°15′ and 51°S (Table 2). Between Jan 23 and Mar 1, 2016 (Expedition Huinay Fiordos 27) and between Apr 27 and May 30, 2016 (Expedition Huinay Fiordos 29), two additional vessel-based expeditions were carried out, each to Seno Escondido, Seno Newman and Estero Slight, with the aim of searching for new carcasses, taking samples for genetic and red tide analyses, and performing oceanographic transects. Data from those surveys are included here, but most of the analyses of the samples will be published in a separate paper.

Samples of marine invertebrates were collected under permit of Subsecretaria de Pesca y Acuicultura (R.EX. 1295 del 27.04.2016). Samples of cetacean carcasses were authorized by SERNAPESCA, Region de Aysen (Acta Numbers 2016-11-10 and 12).

Satellite image

A high-resolution satellite image was taken of Seno Newman on Aug 13, 2015 using the Pleiades-1 Satellite. The 16-bit ortho-rectified GeoTIFF multispectral (R-G-B-NIR) and Panchromatic files have been analyzed to count whale carcasses and determine their geographic positions (Fig. 5). The whales identified in the satellite image were compared to the photos and GPS locations obtained during the overflight, and cross-matched with reference to nearby geomorphological features.

(A) Satellite image on Aug 13, 2015, used to count the carcasses along Seno Newman.

Figure 5: (A) Satellite image on Aug 13, 2015, used to count the carcasses along Seno Newman.

(B–D) Detail of the carcasses highlighted in (A).

Taxonomic analysis

Whales were identified in situ during the vessel-based expedition based on morphological characteristics. The species identification of the specimens from which tissue was sampled during the SERNAPESCA expedition to Estero Slight was confirmed genetically (Fiscalía de Aysén, 2015). A 675 bp fragment of mitochondrial DNA control region was amplified using the primers using the primers M13 Dlp1.5 5′-TGTAAAACGACAGCCAGTTCACCCAAAGCTGRARTTCTA-3′ and 8G 5′GGAGTACTATGTCCTGTAACCA (Dalebout et al., 2005) and sequenced in both directions. Amplification reactions were performed in a total volume of 25 μl with 5 μl PCR buffer 10×, 2 μl MgCl2 50 mm, 1 μl of each primer, 2 μl dNTP 200 mm and 0.3 μl Taq DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA, USA) and 50 ng DNA. The PCR temperature profile was as follows: a preliminary denaturing period of 2 min at 94 °C followed by 30 cycles of denaturation for 30 s at 94 °C, primer annealing for 40 s at 56 °C and polymerase extension for 40 s at 72 °C. A final extension period for 10 min at 72 °C was included.

Taphonomy

Analysis was carried out, following biostratinomic criteria, on different subsets of the whale remains recorded during the overflight and the vessel-based surveys. Characterization of the depositional state of the carcasses was based on a post hoc analysis of the assemblage, exclusively through photographs, classifying the carcasses into three taphonomic classes according to previous studies of biostratinomic processes in marine mammals (Pyenson et al., 2014, Liebig, Taylor & Flessa, 2003; Liebig, Flessa & Taylor, 2007; Schäfer, 1972). The aspects considered were anatomic position of the carcasses (ventral, dorsal or lateral side-up, n = 201), deposition site (rocky or sandy, n = 295), and the disarticulation and degree of decay of the carcasses. These final two aspects were sorted into classes to estimate the sequence of disarticulation/decay addressing two aspects: time since death (n = 245) and drift time/distance of the carcass (as a proxy to estimate the relative location of death, n = 151).

To assess the time since death, three categories were defined, reflecting a straightforward order from the least decomposed to the most disarticulated carcass/skeleton. “Class 1” refers to carcasses in the lowest to relatively medium state of decomposition for these assemblages. Included in this category are complete carcasses with skin, complete carcasses without skin, and complete carcasses with partially exposed bones (see Fig. 6A). “Class 2” includes carcasses in a relatively greater state of decomposition but still maintaining their longitudinal axis, although some bones may be scattered (see Fig. 6B). Finally, “Class 3” refers to isolated skeletal remains with no soft tissue, such as skulls, dentaries or postcranial remains (see Fig. 6C). Thus, the sequence of “time since death” should reflect ranges from less than three months (Class 1), several months, but probably less than six months (Class 2), to a year or more (Class 3).

Biostratinomic classification addressing the decomposition/disarticulation of carcasses/skeletal remains assessing to the time since death.

Figure 6: Biostratinomic classification addressing the decomposition/disarticulation of carcasses/skeletal remains assessing to the time since death.

(A and B) Class 1, carcasses in the lowest to relatively medium state of decomposition. (C and D) Class 2, carcasses in a relatively greater state of decomposition, but still maintaining their longitudinal axis, although some bones may be scattered. (E and F) Class 3, isolated skeletal remains with no soft tissue. Photos: Verena Häussermann (A–D), Photos: Ana Valenzuela-Toro (E, F), all rights reserved.

The analysis of the location of death, namely whether the carcasses are para-autochthonous or allochthonous was addressed by evaluation of the time that the carcasses had remained floating in the water column and at the surface (see Schäfer, 1972). For this, we defined two classes, depending of the presence or absence of the skull, as a proxy for the time floating and the potential distance between the site of mortality and the observed site of deposition (Fig. 7) (Toots, 1965; Voorhies, 1969; Behrensmeyer, 1973; Holz & Simões, 2002; Liebig, Taylor & Flessa, 2003; Simões & Holz, 2004). Thus, “Class A” includes carcasses that preserve the skull and “Class B” includes those without a skull. For this analysis, we excluded skeletons, which were considered older than a year (minimum age, based on field observations of AVT from 2016 expedition to the site of the mortality).

Biostratonomic classification of the location of death of carcasses/skeletal remains.

Figure 7: Biostratonomic classification of the location of death of carcasses/skeletal remains.

(A) Carcasses preserving the skull. (B) Carcasses lacking the skull. Photos: Verena Häussermann (A), Fanny Horwitz (B), all rights reserved.

A geomorphological analysis was made using photographs and Google Earth (Terrametrics, 2015). We classified the type of depositional locality (i.e., sand/pebble dominated beach or rocky outcrop) (Table 2) in order to assess the relationship between these aspects and the taphonomic categories mentioned above; for instance, whether carcasses that had been transported further and disarticulated (allochthonous) were more prevalent at high energy sites (i.e., rocky outcrops) and articulated (para-autochthonous) carcasses more prevalent in low energy environments (i.e., sandy beaches).

To compare the density of the death assemblages at Golfo de Penas with known extinct and extant death assemblages recorded in the literature, we measured linear dimensions of the geomorphological units (i.e., length and width of the beach), through the measure tool in Google Earth, using the highest resolution satellite images available, at sites where assemblages were found. In this manner, the geographic areas corresponding to the death assemblages were calculated and the density determined by dividing the number of specimens in each assemblage by its area.

Analysis of the petrotympanic complex (ear bone)

We studied the bones of the middle and inner ear of one whale, collected during the SERNAPESCA expedition. A volumetric computed tomography in the Morita tomography (box of 60 mm, 500 cuts) was carried out. The images were visualized with Osirix Dicom viewer v 5.6 32-bit in search for fractures or micro-fractures, which would appear as black gaps in the bony tissue.

Analysis for toxins (PST/AST)

Bivalve tissue was sampled in Estero Slight on Apr 22 and on May 25, 2015 (two samples in total), and in Estero Slight, Seno Newman and Seno Escondido between Jan 23 and Mar 1, and Apr 27 and May 30, 2016 (22 samples in total). The stomach content and intestine content of two whales from Estero Slight were sampled on May 25, 2015. On Feb 2016, one sample of duodenum content was obtained from a freshly dead whale observed in Estero Slight. At the same period, one sample of surface-swimming Munida spp. was collected at 46°29.730′S, 74°55.722′W. All samples were analyzed in situ for presence of PST using the protocol already described for the shellfish tissue and stomach content samples. The tissue was homogenized using a blender and mixed in a 1:1 ratio with a field extraction fluid composed of 2.5 parts of rubbing alcohol (70%) to one part white vinegar. The mixture was then homogenized manually and filtered through a paper filter (paper filter #4). The extract obtained after filtration was then used to detect the presence of toxins through rapid field test kits from scotia rapid testing for PST and AST. For this, 100 μl of the extract was placed in a test tube containing running buffer, mixed and then 100 μl of this mixture was placed in a lateral flow enzyme-linked immunosorbent assay (ELISA) test strip with antibodies specific for PST (saxitoxin and its derivative toxins) and AST (domoic acid). These tests were left to develop for 1 h before the results were read.

Twenty-two phytoplankton samples were collected in Estero Slight, Seno Newman and Seno Escondido between Jan 23 and Mar 1, and Apr 27 and May 30, 2016, using a 20 μm mesh size plankton net in a vertical tow from 15 m depth. The phytoplankton present in these samples was concentrated using the net, and a 100 μl subsample was placed in a tube with 0.1M acetic acid and mixed. About 100 μl of this mixture were then added to a test tube-containing running buffer and an aliquot of this mixture of the same volume was placed in an ELISA test strip for PST and left to develop for 1 h before results were read.

These qualitative PST test strips are extremely sensitive due to the local toxin profile, which is high in GTX2/3, resulting in detection limits below 32 μg STX Eq/100 g of tissue. The detection limit for the AST tests was reduced to 2 ppm of domoic acid by modifying the standard sample preparation protocol by eliminating the dilution of the sample before mixing it with the buffer.

A graphical analysis of the geographic and temporal distribution of PSP events, presence of harmful microalgae and environmental variables in the affected region (43°S–51°S) from 2007 to Jul 2015 and from Mar 2016 was performed with the data obtained from the red tide monitoring program conducted by the SERNAPESCA (R.S. Galdames, 2015, personal communication), in which mytilid samples are analyzed at several stations throughout Chilean Patagonia approximately once a month by the “Laboratorios SEREMI Salud,” from Aysén and Magallanes regions at Southern Chile.

Drift model

Floating objects are directly affected by surface currents, wind and waves. Wind both drives the Ekman drift of surface water (Ardhuin et al., 2009) and exerts a direct drag on the emerged surface of an object (Breivik et al., 2012). Stokes drift, the net forward transport due to non-closed particle trajectories resulting from passing waves, also contributes to the transport of floating objects. The drift of whale carcasses was simulated by parameterizing the contribution of these components, based on objects of a similar size from search and rescue models (Breivik et al., 2012; Peltier et al., 2012). Due to the large uncertainty in carcass drift characteristics, parameters were varied stochastically within a wide range of possible values.

Use was made of existing current and wave products, the HYCOM daily 1/12 simulation (Wallcraft, Metzger & Carroll, 2009), and waves from ECMWF ERA-Interim reanalysis (Dee et al., 2011). Winds were taken from a custom downscaling of NCEP NFL boundary conditions using the WRF model (Skamarock & Klemp, 2008) to a sub-4 km grid size. Drift scenarios were run by stepping forward in time from hypothetical sites and times of mortality. All of these sites were in shallow water, since carcasses resulting from mortality in deep water have a tendency to sink and not resurface (Smith et al., 2015). A horizontal diffusion coefficient of 10 m2s−1 was included in drift tracks to represent unresolved physical processes. While the resolution of the current and wave datasets is inadequate to represent detailed coastline or seabed geometry, or the interior of the fjords, the drift model does clarify the expected distribution and spread of carcasses from localized sources.

Large-scale wind stress

The large-scale tendency toward upwelling or downwelling provides a key driver of coastal ecosystems. This was assessed using ECMWF ERA-Interim reanalysis data (Dee et al., 2011). It is the alongshore component of wind stress that drives Ekman transport normal to the coast and consequent upwelling or downwelling. Since upwelling and downwelling are cumulative processes, a time-integrated wind stress was calculated (Pierce et al., 2006) from a base time of the vernal equinox (September 21). Stress was estimated from reanalysis winds at 10 m elevation according to Large & Pond (1981). The large-scale change in coastal orientation was taken into account in extracting the alongshore wind component, although localized inlets, bays (including the Golfo de Penas) and islands were not considered.

Results

Field surveys and toxicity tests

Of the total of dead whales observed in all expeditions and reports in 2015 (367), 35 recently dead whales and 12 skeletal remains were discovered during the HF24 expedition: 31 carcasses and 12 skeletal remains were found in and close to the entrance of the 14 km long Estero Slight and four carcasses in Canal Castillo, situated 235 km to the south, as well as many whale bones on different beaches (Fig. 3; Table 2). Three hundred and five carcasses were mapped during the overflight between the Jungfrauen Islands (∼48°S) and Seno Newman (46°39′S). In addition to this total of 284 whale carcasses and 21 skeletons from the two surveys, 51 whale carcasses and 11 whale skulls were reported between Feb and Jun 2015 by boat crews navigating the west coast of Taitao Peninsula and the coast between 49°15′ and 51°S (Table 2; Fig. 4).

On some photos what could have been carcasses of smaller animals (possibly dolphins and/or sea lions) were seen, but due to the flying altitude, speed and weather conditions, the photo quality and resolution did not allow their conclusive identification as actual carcasses. In Estero Slight, one dead pinniped was found on the shore from the vessel. During the SERNAPESCA expedition, one Otariidae skull was found and photographed in the same channel but the correspondence of the carcass and the skull could not be established.

The 28 whale carcasses that could be identified unambiguously to species level were all sei whales (Balaenoptera borealis); 15 of these identifications were confirmed genetically. Seven specimens could be identified as males and ten as females. One hundred and twenty-nine carcasses were identified as baleen whales of the Balaenopteridae family or rorquals. The 30 whales examined in detail in Estero Slight during the vessel-based expedition were between 6 and 15 m long, hence included both juvenile and fully grown specimens.

None of the examined whales showed any evidence of disease or traumatic damage. The anatomic structures of the ear bone were in good condition showing no damage; the stapes were articulated in place, and the bony tissue showed no fractures (Fig. 8). The analysis of locally collected mytilids in Apr and May 2015 and of the stomach and intestine content of two whales in May 2015 showed presence of PST and AST.

Digital images obtained through computed volumetric tomography (CVT) scanned at Morita tomography (box of 60 mm, 500 slices).

Figure 8: Digital images obtained through computed volumetric tomography (CVT) scanned at Morita tomography (box of 60 mm, 500 slices).

All acoustic anatomical structures of the middle ear (ossicles: stapes), internal ear (cochlea: spiral lamina), and the semicircular canals are seen in perfect condition. Transversal sections of the pars cochlearis of the periotic: (A) midline, (B) more anterior; sagittal sections of the pars cochlearis of the periotic, (C) anterior, (D) midline and (E) posterior; Lateromedial sections of the pars cochlearis of the periotic: (F) lateral, (G) half-length and (H) medial.

In 2016, 16 fresh carcasses were observed during the HF27 and HF29 vessel-based expeditions to Golfo Tres Montes; five further were reported by boat crews navigating the Southern part of Chilean Patagonia. None of the examined whales showed any evidence of disease or traumatic damage. Thirty-six rapid tests on PST were run using mussels (12 tests), Munida (two tests), and phytoplankton (22 tests) in Seno Escondido, Seno Newman and Estero Slight. Most of the samples collected during the 2016 expeditions proved to be negative for the presence of PST, nevertheless, both expeditions detected the presence of PSP in the phytoplankton collected at the entrance of Seno Newman. A sample collected at the head of Seno Newman was negative for PST, indicating that the toxic phytoplankton was preferentially located at the mouth of this inlet and nearby areas of the Canal Chaicayán.

Biostratinomic analysis

Of the 367 dead whales observed in 2015, 305 carcasses were mapped between Seno Newman (46°39′S) and Jungfrauen Islands (∼48°S). Those carcasses could be grouped into five assemblages (Figs. 1 and 9; Table 2), defined as a group of carcasses in close proximity. The assemblages were called Golfo de Penas, Jungfrauen Islands, Seno Escondido, Seno Newman and Estero Slight.

Maps showing the five assemblages of whale carcasses.

Figure 9: Maps showing the five assemblages of whale carcasses.

(A) Golfo de Penas, (B) Seno Escondido, (C) Seno Newman, (D) Estero Slight and (E) Jungfrauen Islands. State of decomposition color-coded: yellow (state 1; least decomposed, all articulated), orange (state 2; intermediate decomposed), and red (state 3; isolated remains).

Some carcasses were floating (11), but most (284) were deposited ashore (Figs. 35). The greater proportion of carcasses were deposited in a lateral position and to a lesser extent in the ventral-up position reflecting the hydrodynamics of the body in the sea as determined by the inflation of the abdominal region and mainly of their tongues, as observed in a recently dead individual and in some decayed carcasses at Golfo de Penas (Fig. 10). In general, they were tide-oriented (parallel to the coastline) and all of the classified carcasses from the overflight were lying on their back or side (ventral-up, 44.3%; lateral-up, 55.7%) (Table 3; Fig. 11C), while only one specimen (from HF24) was found in a dorsal-up position (data not included in analysis due to different time of observation).

Inflation of the tongue and its implication for whale carcass deposition.

Figure 10: Inflation of the tongue and its implication for whale carcass deposition.

(A) Inflated tongue in a very recently dead sei whale (weeks) indicated by the arrowhead. (B) Close-up of the mouth with dislocate mandibles due to the previous inflation of the tongue (arrowhead), which is decayed and removed by scavengers. (C) Whale carcass seen from the overflight deposited in lateral position and its protuberant inflated tongue (arrowhead). Photos: Brice Monégier (A), Verena Häussermann (B, C), all rights reserved.
Table 3:
Anatomical position.
Proportion of carcasses in each anatomical position as recorded from the overflight survey and posterior photographic analysis.
Anatomical position of Carcass Unknown Dorsal-up Ventral-up Lateral-up Total
Count 187 0 43 54 97
Proportion (%) 65.84 0 15.14 19.01 100
Proportion (%) based on classified individuals only 0 44 56 100
DOI: 10.7717/peerj.3123/table-3
Graphs showing the proportion of the total classified carcasses in the biostratonomic analysis.

Figure 11: Graphs showing the proportion of the total classified carcasses in the biostratonomic analysis.

(A) Time since death. (B) Time since death, combining Class 1 and 2. (C) Location of death and (D) Anatomical positions of carcasses (lateral, ventral and dorsal-up).

With respect to the classification of “time since death,” 68.8% of the carcasses were classified in Class 1 (less than three months), 24.9% in Class 2 (less than six months) and 6.3% in Class 3 (more than a year) (Figs. 11A and 11B; Table 4). With respect to “time at sea,” 147 (87%) of the carcasses were classified in Class A (short time/distance of drift), while only four (13%) were identified as Class B (long time/distance of drift) (Fig. 11C; Table 4). There was no pattern relating the geomorphological unit (sandy: 34%, pebble: 27%, rocky beach: 34%) to the taphonomic classes.

Table 4:
Minimal number of individuals (MNI).
Estimation of minimal number of individuals are given to each of the classes of decomposition/disarticulation stages recorded at Golfo de Penas.
Classes of decomposition Class MNI Proportion (%)
Time since death 1 141 68.78
2 51 24.88
3 13 6.34
Total 205 100
Time at sea A 147 97.35
B 4 2.64
Total 151 100
DOI: 10.7717/peerj.3123/table-4

The carcasses found in April in Estero Slight were classified in stage 2 of Geraci & Lounsbury (2005) indicating a few days to weeks since death; this would be classified as Class 1 in the taphonomic classes of the present study.

The density of whale carcasses was in average 1,050/km2, considering all assemblages recognized (Table 5).

Table 5:
Density of specimens in assemblages (specimens/km2).
Area (km2) Number of specimens Density (specimens/km2)
Assemblage 1—Jungfrauen group 0.19 30 156
Assemblage 2—Escondido inlet 0.02 47 1,906
Assemblage 3—Escondido inlet 0.01 32 1,987
Assemblage 4—Newman inlet 0.60 149 248
Assemblage 5—Slight inlet 0.04 40 952
Total area of assemblages/specimens 0.87 298 341
Average 0.17 59 1,050
DOI: 10.7717/peerj.3123/table-5

Carcass drift and potential source locations

The distribution of beached carcasses was simulated from four illustrative source locations (Figs. 12A12D). In each case, calculations tracked 13,000 hypothetical carcasses, reflecting source times spanning a two-month period from mid-February to mid-April 2015 and a range of drift model parameters. The spread of stranding locations therefore represents variability of the current, wind and wave environment during this period as well as the uncertainty in model parameters and a diffusive component to the drift tracks. While each of the illustrated source locations leads to strandings distributed over several hundred kilometers of coastline, there are important differences in these distributions. A simulated source in Golfo Tres Montes (Northern Golfo de Penas) leads to strandings throughout the Golfo de Penas (Fig. 12A), including in the Golfo Tres Montes itself. No other source location (Figs. 12B12D) leads to strandings in Golfo Tres Montes due to the direction of prevailing currents and the sheltering effect of Peninsula Taitao. Similarly, only a source to the north of Peninsula Taitao leads to strandings in that region (Fig. 12B). Carcasses originating in the Golfo de Penas have a tendency to be transported to the south by prevailing currents (Figs. 12A, 12C and 12D).

Location of beached carcasses (blue) predicted by the drift model from four possible mortality locations (A–D, red stars).

Figure 12: Location of beached carcasses (blue) predicted by the drift model from four possible mortality locations (A–D, red stars).

Mortalities during a two month period are simulated, from mid-February to mid-April 2015, with multiple carcasses (n = 200) of varying drift properties released each day to predict the range of resulting carcass locations. Green vectors show time-averaged surface currents for this period (HYCOM model). Depth contours at 50 and 100 m are indicated (GEBCO), although nearshore waters and inlets are not resolved.

Inter-annual variation in upwelling or downwelling

Comparison between the cumulative alongshore wind stress for the year in question and the previous 20 years (Fig. 13) reveals that the months immediately prior to the mortality event were anomalous. North of the study area, at 45°S, there was an anomalously strong tendency toward upwelling (an upward trend in Fig. 13), making this one of the most upwelled years of the period. At the latitude of Golfo de Penas and further south there was a net tendency to downwelling (a downward trend in Fig. 13), but punctuated by upwelling events, making this one of the least downwelled years of the period.

Cumulative alongshore component of nearshore wind stress (red) from ECMWF ERAInterim reanalysis winds at latitudes (A) 49°S, (B) 47°S, (C) 45°S, with an origin time of the vernal equinox, Sep 21, 2014.

Figure 13: Cumulative alongshore component of nearshore wind stress (red) from ECMWF ERAInterim reanalysis winds at latitudes (A) 49°S, (B) 47°S, (C) 45°S, with an origin time of the vernal equinox, Sep 21, 2014.

Gray shading shows the envelope of variability experienced during 1995–2014, with darker shading indicating one standard deviation from the mean for this period. Vertical lines show the timing of vessel (green) and aerial (blue) observations of whale carcasse.

Discussion

Possible causes of death (Table 6) need to be analyzed for a mechanism that is capable of synchronous killing of hundreds of whales, apparently all or most of the same species (with a few exceptions, i.e., one confirmed pinniped). Baleen whales, in contrast to odontocetes, are less social and do not use echolocation to navigate (Perrin, Mead & Brownell, 2009). The latter characteristics are key aspects used to explain mass mortalities in odontocetes.

Table 6:
Comparison of the usual causes of death with the evidence encountered at Golfo the Penas.
Cause of death for marine mammals Main feature Type of evidence (confirm–discard) Observation at Golfo de Penas Expected in rorqual event Oceanographic conditions near time of death Rorqual species recorded References Oceanographic conditions observed at GP
Starvation by abundance surpassing carrying capacity Thin blubber layer, or empty stomach, or numbers around 5% of population Measurements, necropsy and population numbers nearby carrying capacity Not likely, sei whales are still recovering from whaling, last species to be hunted Reported in one species Low productivity event Reported in gray whales (Eschrichthius robustus) Gulland et al. (2005) High productivity event
Epidemic disease Morbillivirus: contagious-epidemic, emaciated, external and internal parasites, lesions and inflammatory reactions Histology, parasitology–virology test No signs of external or internal lesions in the whales of Estero Slight
Stomach content present
No test available
Low numbers, young individuals Shift in temperature, anthropogenic contamination, mutation of virus Juveniles and calves fin whales,
Balaenoptera physalus
Brongersma-Sanders (1957), Jauniaux et al. (2000), Shimizu et al. (2013), Van Bressem et al. (2014), Mazzariol et al. (2016) Unknown
Military exercise with sonar Only confirmed in dolphins Ear damage and—or hemorrhage nearby the ears Unknown Unknown No military exercises public programed,
Chilean law for the protection of whales
Unknown Goldbogen et al. (2013), Nowacek et al. (2007), Southall et al. (2009) Not reported
Poisoning by toxins of harmful algal bloom Massive, multispecific, recurrent in time HAB reported, shift in oceanographic conditions, El Niño event Yes Yes High productivity event, El Niño influence Balaenoptera physalus, Megaptera novaeangliae, Balaenoptera acutorostrata Geraci et al. (1989), Fire et al. (2010), Pyenson et al. (2014), Brongersma-Sanders (1957) (present work) Yes, at the closest station of red tide monitoring
Trauma: ship collision/entanglement Evidence of trauma, small number (i.e., eight deaths in 19 years in USA) Lesions, hematoma No sign of internal or external lesion Yes (small number of individuals at a time) Not related Eubalaena glacialis Kraus (1990), Moore et al. (2004), Vanderlann & Taggart (2007) Not related
DOI: 10.7717/peerj.3123/table-6

Possible causes for the death of hundreds of baleen whales include a lethal and highly contagious unknown virus or infection, noise-related mechanisms at sea, and intoxication by biotoxins (domic acid, saxitocin, etc.; Geraci et al., 1989; Fire et al., 2010; Lefebvre et al., 2016; Pyenson et al., 2014; Table 6). In this assemblage, the individuals could not be tested for viruses or bacteria, due to their advanced state of decomposition. There was no evidence of pathological modifications that could be attributed to such a cause; however, it is not possible to completely discard this hypothesis.

The only potentially lethal noise-related mechanism for a baleen whale are very intense noises associated with blasting in close proximity (Ketten, 1992). This could injure the animal and cause hemorrhage or provoke panic, disorientation and favor entrapment (not yet described for baleen whales, Goldbogen et al., 2013). Although there was no evidence of bony damage or micro-fracture of the one examined periotic, this cannot be excluded for the other individuals. Any other noise-related damage could neither be ruled out due to the decomposition of the soft tissue structures, nevertheless, there is no evidence that for baleen sonar and ground noise could trigger more than non-lethal behavioral and temporary effects (Goldbogen et al., 2013). The strongest argument against this hypothesis is that whales died synchronously along hundreds of kilometers of shoreline and at least five different sources of carcasses were identified (see discussion on drift models), which could only be explained by a large number of blastings along the coast during a very restricted time period. The study carried out by SERNAPESCA (Fiscalía de Aysén, 2015; Ulloa et al., 2016, available upon request from SERNAPESCA authorities) based on partial necropsies of two whales in late May 2015, found no evidence of any trauma or human interaction. The whales were already in decomposition stages 3–4 and Class 1 of taphonomic classes used here.

Paralytic shellfish toxin is known to accumulate in the pelagic stage of the squat lobster Munida gregaria (MacKenzie & Harwood, 2014), an important prey of sei whales (Matthews, 1932). Older reports (Tabeta & Kanamura, 1970) and recent observations by boat crews (K.-L. Pashuk, 2015, personal communication) indicate that squat lobster abundance fluctuates strongly and can reach extremely high concentrations, especially in Golfo Tres Montes (Tabeta & Kanamura, 1970). The presence of PST in mytilids from the area and in the whale carcasses and the absence of evidence for other causes of death leaves PSP as the most probable cause of death (Table 6). Although AST was also detected in one of the stomach content samples, it is not believed to be the cause of the MME as it was not detected by the toxin monitoring stations. A mixed assemblage of 40 skeletons from the Miocene in the north of Chile, dominated by rorqual whales and attributed to four recurrent HAB events, shows many similarities to the assemblages described here (Pyenson et al., 2014). The characteristics of the MME and the repetition in the same locality are common features for HAB-mediated mortalities (Brongersma-Sanders, 1957) (see Tables 6 and 7). MMEs through PSP in rorquals are thus not a recent phenomenon in the Southeast Pacific. Nevertheless, whalebone accumulations and reports of mortalities in Chilean Patagonia of up to 15 rorquals going back to at least 1977 suggest an increase in the frequency of mortalities (Table 8). Since the early 1990s, HABs have been recorded every year in spring and autumn along the entire Patagonian coast, patterns are patchy and generally restricted to bays and fjords. The same is true the coast of the Northeast Pacific where HAB events have been increasing in strength and extension (Cook et al., 2015). This MME coincided with increased mortality of baleen whales along the west coast of North America in 2015 (NOAA, 2015b), and with the most extended and longest lasting HAB event registered there (NOAA, 2015c). A positive correlation between the occurrence of PST blooms and the ENSO indices in northern and central Patagonia has been shown (Cassis, Muñoz & Avaria, 2002; Guzmán & Pizarro, 2014). A similar correlation between the abundance of toxic harmful algae and surface temperatures, which in turn are affected by ENSO, was observed in Aysén by Cassis, Muñoz & Avaria (2002). El Niño events have increased in frequency and strength due to global warming (Cai et al., 2014). A strong El Niño event began to build in Sep 2014, which became the strongest El Niño of all time (NOAA, 2015a). The calculated cumulative windstress (Fig. 13) suggests that during this period there was an anomalous tendency toward coastal upwelling and associated nutrient delivery. Exceptionally high levels of PST, 10 times higher than usual peaks were reported in Mar 2015 from the closest monitoring site 120 km north of the mortality area (Isla Canquenes, Fig. 14).

Table 7:
Main biostratinomic pathways and their significance in understanding the thanatocenosis.
Time since death Condition of the carcasses Age proportions Sex proportions Geographic position Observed
Catastrophic—single event Highly homogenous
Majority within one to a few classes (42)
Same as population rate Same as population rate Homogenous Homogenous; see Table S2
Time averaged Highly heterogeneous
Several classes present
Same as proportion of annual mortality of the population No pattern, different from ratio of population Heterogeneous Homogenous; see Table S2
Location of death Condition of the carcasses Anatomic position expected Anatomic position expected Orientation Anatomic position observed
Autochthonous Very well preserved, low disarticulation Position of life: dorsal-up (5) Dorsal-up No trend Dorsal-up: 1.00%
Allochthonous Disarticulation and scattering present, depending on time and distance to final deposit Heterogeneous depending on time since death or time of drift
Majority ventral to lateral up (5, see Fig. S5)
Ventral-up—lateral-up One main direction (current-wind) and/or two main directions (tide) Ventral-up: 20.40%
Lateral-up: 78.61%
DOI: 10.7717/peerj.3123/table-7
Table 8:
Sei whales observed in Chilean Patagonia (whaling ended in 1976).
Region/site Number of whales Time span Distance to shore (mi) Source
43–45°S 286 Mar 25–Apr 03, 1966 60–70 Aguayo-Lobo (1974)
39–41°S 345 Oct 09–20, 1966 60–120 Aguayo-Lobo (1974)
46–48°S 114 Dec 13–23, 1966 20–60 Aguayo-Lobo (1974)
Golfo de Penas (∼46°30′–48°S) 600 Mar 1966 11–24 L. Pastene, 2015, personal communication
Golfo de Penas (∼46°30′–48°S) Small number May 25–28, 1971 Inshore Gilmore (1971)
53–55°S Large concentrations Feb 1994 Not mentioned Pastene & Shimada (1999)
Slight inlet (∼46°45′S) Two Jul 2015 Near to shore J. Cabezas, 2015, personal communication
DOI: 10.7717/peerj.3123/table-8
Spatial distribution of PST (STX. Eq./100 g tissue) as measured in mytilids and the relative abundance of Alexandrium catenella between 43°S and 51°S in Mar 2015.

Figure 14: Spatial distribution of PST (STX. Eq./100 g tissue) as measured in mytilids and the relative abundance of Alexandrium catenella between 43°S and 51°S in Mar 2015.

Inset shows the toxin level at the closest site to the Golfo de Penas, Isla Canquenes (45°43′31″S; 74°06′51″W) measured between Mar 2010 and Mar 2015. Shellfish consumption is unsafe for humans if values rise above 80 μg STX. Eq./100 g tissue.

The presence of PST during Feb 2016 was accompanied by deep red/brown surface water discoloration due to the high abundance of Alexandrium catenella. This HAB was coincidental with an unusually large bloom of the same toxic species in the waters around Chiloé island (42°S) (Hernández et al., 2016). The May 2016 expedition did not observe water discoloration at this location, nevertheless the phytoplankton samples obtained at the mouth of Seno Newman were also positive for PST, indicating that this toxic species can be present in the area for long periods of time during the summer. The PST levels at Isla Canquenes were not elevated in 2016; however, at two sites in the Messier Channel levels four and seven times higher than usual peaks, were measured (Fig. 15).

Spatial distribution of PST (STX. Eq./100 g tissue) as measured in mytilids between 43°S and 51°S in Mar 2016.

Figure 15: Spatial distribution of PST (STX. Eq./100 g tissue) as measured in mytilids between 43°S and 51°S in Mar 2016.

In 2016, the PST levels in the Golfo Tres Montes region were not elevated. However, values four to seven times higher than usual peaks were measured in the channels of Central Patagonia. Shellfish consumption is unsafe for humans if values rise above 80 μg STX. Eq./100 g tissue.

Rorqual whales sink shortly after death (Smith et al., 2015). Once carcasses have sunk below a depth of 50–100 m, they tend not to re-float since hydrostatic pressure compresses decomposition gases (Smith et al., 2015). The bathymetry in the Golfo de Penas area and off the steeply sloping Taitao Peninsula (Fig. 12) requires that the whales that washed ashore all died near the shore. Thus, we conclude that despite common belief (Perrin, Würsig & Thewissen, 2009) sei whales opportunistically feed close to shore and may even follow their prey into narrow and shallow inlets and channels. This hypothesis is supported by the fact that live sei whales were observed near shore in Golfo de Penas and Estero Slight on several occasions (Table 8).

The drift model suggests that the observed carcasses originated from multiple sites. The carcasses found in the two fjordic inlets of Seno Newman and Estero Slight (62% of the total) probably died not far from where they stranded, either in the Golfo Tres Montes or within the inlets themselves (Figs. 1 and 9), since source locations elsewhere in Golfo de Penas or north of Taitao Peninsula do not lead to carcasses in this region (Figs. 12B12D). Although the inlets themselves are not resolved in the drift model, the net seaward surface outflow of a fjord would only allow carcasses to collect toward its head (as observed) if wind and waves in that direction dominated their drift, or if they died close to the site where they were found. Modeled winds were occasionally toward the head of Seno Newman, on Mar 20 and during Apr 14–18, but almost never in the case of Estero Slight (Fig. 16), so it is highly likely that the carcasses found within these inlets were the result of mortality within the inlets themselves. Carcasses from within these inlets could, however, be exported to nearby coastal waters and then distributed around Golfo de Penas as seen in the drift simulations for a source in Golfo Tres Montes (Fig. 12A), so mortality within the inlets of Seno Newman and Estero Slight could have been the source for carcasses found elsewhere in Golfo Tres Montes or Golfo de Penas.

Wind roses at the entrance to two inlets, Seno Newman (A) and Estero Slight (B), derived from a local high-resolution implementation of the WRF model.

Figure 16: Wind roses at the entrance to two inlets, Seno Newman (A) and Estero Slight (B), derived from a local high-resolution implementation of the WRF model.

Spoke lengths indicate the frequency of occurrence of winds from each direction. Colors represent speed. Seno Newman has a significant up-inlet component (winds from SSW) but Estero Slight does not (winds from NNE).

The accumulation of carcasses in the convoluted and extremely shallow Estero Escondido is similarly unresolvable by the drift model, but it also appears highly likely that these carcasses resulted from mortality within the inlet itself. It is, however, unclear why dozens of large whales would swim into a narrow inlet which in most parts is only between 2 and 7 m deep (maximum depth 15 m just inside extremely shallow entrance) (Fig. 17).

Nautical maps of Escondido and Slight Inlet.

Figure 17: Nautical maps of Escondido and Slight Inlet.

(A) Section of the Bahia San Quintin showing Escondido Inlet (maximum depth 15 m). (B) Section of Hoppner Bay showing Estero Slight (maximum depth 152 m). Sources: Map nr 8820 and 8810 from armada de Chile. Newman Inlet is poorly charted with only five depths indicated along the inlet, the largest being 82 m.

Drift predictions from sources within Golfo de Penas, or to the south (Figs. 12A, 12C and 12D), never led to carcasses on or to the north of Taitao Peninsula, therefore the observed carcasses on the exposed shoreline in that region (Estero Cono) likely originated close to shore, either locally or to the north. The carcasses found between the Southern end of Golfo de Penas and 49°S either died very close to where they washed ashore or were transported from the large concentrations in Golfo de Penas by clockwise flow within the gulf. The five whales between 49°S and 51°S probably died locally.

Surveys in the Golfo de Penas area have sighted sei whales in all seasons, with up to 600 individuals, some even near to the shore of Golfo de Penas and Estero Slight (Table 8). Therefore, the number of whales that have been exposed to toxins could be considerable. It has been calculated that less than 10% of the gray whales that are estimated to die each year in the eastern North Pacific are washed ashore, while most sink and do not resurface (Rugh et al., 1999). Assuming a similar ratio, our observations may greatly underestimate the actual magnitude of this mortality event. Many whales may have sunk and never re-surfaced, and a significant number of carcasses may have been washed ashore on the many remote beaches that could not be surveyed due to adverse weather conditions. Others may have been destroyed by wave action from winter storms on the high-energy rocky shores that dominate the area.

In other reported MMEs, the period of the time of a massive mortality was determined by considering the number of carcasses, and their temporal and spatial extent. This ranged from two years (gray whales; Gulland et al., 2005) to a few weeks (humpback whales; Geraci et al., 1989). To determine the time span of this MME, the classification of carcasses was carried out following the disarticulation sequence proposed by Schäfer (1972).

Time since death and time of transportation at sea of the carcass are slightly different in terms of articulation and state of decomposition. Following Schäfer (1972), the first breakage of the outer tissue of a carcass at sea should occur within a week to a month, although in Chilean Patagonia the time span could be a little greater due to the low temperature. In addition, some carcasses could have drifted for some weeks, arrived intact on shore, and then decayed more rapidly exposing the bones, while other carcasses could have floated longer until skull, tail and limbs were disarticulated, but decayed more slowly due to the colder water temperatures. This was in agreement with the comparisons of the disarticulation of carcasses in the field assessed through the photographs of the different expeditions to the same area (Estero Slight, in Apr and May 2015). Nevertheless, at the present assemblage, the time until the bones were exposed was extended from one to around three months (Class 1) and time of disarticulation was shifted from three to six months (Class 2), due to the low average temperature in the study area.

Considering available information on MMEs time scales, it is reasonable to suppose this event occurred over a time span of approximately three to maximum six months (Nov 2014–Apr 2015). Nevertheless, the record of other crews (Table 2) and modeled oceanographic conditions (see “Carcass drift and potential source locations,” above) point to the beginning of the die off around February at Golfo de Penas. Thus, the Class 2 carcasses would indicate another pulse of corpses arriving at the same area in a different taphonomic condition, which could suggest: (a) longer drift time/distance transport; (b) equal arrival but different time of death; or (c) higher energy environment. The classification of “time at sea” analysis suggested that drift time was in its majority the same with a similar proportion of Class A (short drift time/distance). The analysis of the anatomic positions suggests the allochthonous nature of the deposits in all assemblages (see Pyenson et al., 2014). Only two carcasses were found in a dorsal up position, which suggests live stranding.

The average density of Golfo Tres Montes assemblages is equivalent to one third of the density calculated for Cerro Ballena, a Late Miocene (∼9 Mya) fossil red tide linked assemblage of northern Chile (3,000/km2, Pyenson et al., 2014) (Table 5). However, this difference is likely to have a sampling bias since in Golfo Tres Montes and Golfo de Penas we could only could the carcasses along the coastline, but not on the seafloor.

Conclusion

  1. The whales died at sea, close to where they beached. About 90% of the whales died during one MME (94.7% for time since death and 87% for time at sea analysis), most probably between Feb and Apr 2015. No major mortality has occurred in the same area in 2016, but mortalities in other areas cannot be excluded (see Fig. 15 for 2016 toxin levels).

  2. Since it is likely that all or most of the affected whales were sei whales, the documented mortality may represent a significant increase over the usual death rate of Southern Hemisphere sei whales (Reilly et al., 2008). If the frequency and magnitude of MMEs increase due to climate change this would have a significant impact on the local population and threaten the recovery of this endangered species, which in the Southern Hemisphere was reduced by whaling from about 100,000 to 24,000 individuals by 1980 (Perrin, Würsig & Thewissen, 2009).

  3. This MME and historical data suggest that, at least during years with abundant squat lobsters, the Golfo de Penas is one of the most important feeding grounds for sei whales, hosting the largest and densest known sei whale aggregations outside the polar regions.

  4. The MME reported herein and its probable connection to El Nino-caused red tide events throughout the Eastern Pacific could indicate that marine mammals are among the first oceanic megafauna victims of global warming.

  5. Discoveries of dead whales in this remote area are chance finds. To clarify the extent, frequency and magnitude of MMEs, an assessment and systematic monitoring of whale populations in Central Chilean Patagonia is necessary. We suggest to do this through regular satellite images.

Supplemental Information

National Fisheries Service cruise report.

DOI: 10.7717/peerj.3123/supp-1