Identification of immunological and prognostic value of SHROOM2 in pan-cancer and experimental verification of its role in promoting malignant phenotypes in breast cancer

Differential expression analysis

RNA-sequencing (RNA-seq) data across multiple cancer types were retrieved from TCGA (https://portal.gdc.cancer.gov) and the Genotype-Tissue Expression (GTEx, http://www.gtexportal.org/) databases using the STAR pipeline. The data were processed and converted to the transcripts per million (TPM) format. To ensure data quality, duplicate and incomplete RNA-seq samples were excluded, and the remaining data were transformed to the log2(TPM + 1) format. SHROOM2 expression levels were assessed between normal and tumor tissues via the Wilcoxon rank-sum test, with specimens stratified into high- and low-expression groups based on the median SHROOM2 expression threshold.

Survival and clinicopathological analyses

Clinical follow-up and clinicopathological data were sourced from TCGA (https://portal.gdc.cancer.gov). To reduce potential bias in statistical analysis, individuals with incomplete overall survival (OS) data, those with a follow-up duration of less than 30 days, and male patients with BC were excluded from both the breast cancer gene (BRCA) and pan-cancer datasets. Progression-free interval (PFI) was defined as the time from the initiation of treatment to cancer progression or death from any cause. Disease-specific survival (DSS) was calculated as the time from diagnosis to death attributable to the specific cancer, with deaths from other causes treated as censored. OS was defined as the time from diagnosis to death from any cause. Survival analysis was conducted using Cox proportional hazards regression, with statistical significance determined at P < 0.05.

Samples from TCGA-BRCA were categorized based on estrogen receptor (ER) status, progesterone receptor (PR) status, age, and PAM class. SHROOM2 expression was evaluated and compared across these categories using the Wilcoxon rank-sum test. Additionally, survival analysis was performed within subgroups stratified by these clinicopathological characteristics to assess the prognostic value of SHROOM2 expression in BC.

Enrichment analysis

Gene set enrichment analysis (GSEA) was performed to assess the potential impact of SHROOM2 levels on cancer-associated pathways, with the results displayed in a heatmap. Furthermore, the role of SHROOM2 expression in BC was explored by applying GSEA to identify pathways associated with genes influenced by SHROOM2 in BC.

Assessment of immune characteristics

SHROOM2’s impact on immune-related features was evaluated by examining its association with immunomodulators, immune checkpoints, and immune cell infiltration (ICI). Gene catalogs for immune checkpoints and immunomodulatory factors were retrieved from TISIDB (http://cis.hku.hk/TISIDB/download.php). Immunomodulatory scores were then compared between high- and low-SHROOM2-expression groups to determine the relationship between SHROOM2 expression and immunomodulatory genes across cancer types.

ICI data were sourced from TIMER2.0 (http://timer.cistrome.org/), and infiltration scores for various immune cell populations were assessed using the TIMER, EPIC, MCP-COUNTER, CIBERSORT, CIBERSORT-ABS, QUANTISEQ, and XCELL tools. Heatmaps were generated to visualize the correlation between ICI and SHROOM2 expression levels across cancers. Furthermore, the ESTIMATE algorithm was employed to analyze these associations in both pan-cancer and BC.

Immune activity scores were calculated using the Tumor Immunophenotype tool (http://biocc.hrbmu.edu.cn/TIP/). These scores were compared between high- and low-SHROOM2-expression groups to evaluate the link between SHROOM2 expression and immune activity.

Finally, immune checkpoint scores were compared between the high- and low-SHROOM2-expression cohorts to assess the correlation between SHROOM2 expression and immune checkpoint genes across cancer types.

TMB and drug sensitivity analyses

TMB and drug sensitivity analyses were conducted to assess tumor heterogeneity and predict the efficacy of immunotherapy. TMB scores in the pan-cancer dataset were calculated using the “maftools” package (Mayakonda et al., 2018). The relationship between SHROOM2 expression and TMB scores was then examined.

The chemotherapeutic response of each sample was predicted using drug sensitivity data from the Genomics of Drug Sensitivity in Cancer (GDSC) database (https://www.cancerrxgene.org/), the largest publicly available pharmacogenomic resource (Geeleher, Cox & Huang, 2014). The “pRRophetic” R package was employed for prediction, with half-maximal inhibitory concentration (IC₅₀) values determined via ridge regression (Jiang et al., 2021). Default settings were used for all parameters. Batch effects were corrected using ComBat, and gene expression values from different tissues were averaged to address duplicates.

Cell culture and siRNA transfection

To explore the involvement of SHROOM2 in breast cancer pathogenesis, in vitro experiments were performed using MCF7 (ATCC HTB-22) and MDA-MB-231 (ATCC HTB-26) cell lines. Both cell lines were cultured in DMEM supplemented with 10% FBS at 37 °C in a 5% CO₂ atmosphere. SHROOM2-specific siRNA duplexes (GenePharma, custom-designed) and negative control siRNA (NC) were transfected into the cells using the siRNA-Mate plus reagent (#G04026; GenePharma), following the optimized protocol outlined in Table S1. Knockdown efficiency was assessed 48 h post-transfection via qRT-PCR. Each biological experiment included three independent replicates.

CCK-8 assay

To assess the role of SHROOM2 in breast cancer in vitro, SHROOM2 expression was knocked down using siRNA, and the subsequent effects on cellular behavior were evaluated. The siRNA sequence used was: forward, GCACAUCUGAGCAGUUCUATT; reverse, UAGAACUGCUCAGAUGUGCTT. Cell proliferation was measured by CCK-8 assay. Specifically, MCF7 and MDA-MB-231 cells were seeded into 96-well plates at a density of 5,000 cells/100 µL of culture medium. The effect of SHROOM2 knockdown on cell proliferation was determined by measuring absorbance at 450 nm at 0 h, 24 h, 48 h, and 72 h intervals.

Transwell assay

Cell migration was assessed using a Transwell assay. MCF7 and MDA-MB-231 cells were resuspended in DMEM without fetal bovine serum (FBS) at a concentration of 2 × 10⁴ cells/mL. A 100 μL aliquot of the cell suspension was added to the upper compartment of a Transwell insert, while the lower chamber contained 500 μL of DMEM supplemented with FBS. After the incubation period, non-migratory cells were removed with a cotton swab, and cells that had migrated through the membrane were fixed with 4% formaldehyde, stained with 0.1% crystal violet, and counted.

To assess invasive capacity, a mixture of DMEM without FBS was prepared at a 1:7 ratio with stroma (Beyotime, Guangzhou, China). A 50 µL volume of this mixture was added to the upper chamber, and incubation was carried out for 3–4 h. The subsequent steps were identical to those used in the migration assay.

qRT-PCR

Total RNA was extracted from MCF7 and MDA-MB-231 cells using the Vazyme RNA Isolation Kit (Vazyme, Nan Jing, China). Complementary DNA (cDNA) synthesis was performed from the isolated RNA following the manufacturer’s protocol with a reverse transcription kit (Vazyme). The resulting cDNA was amplified using the following primers: forward, AGTTCTACTCGCGCTTCTGT; reverse, CCTTCATGTAGCTGAGCCCT. Gene expression levels were quantified using the 2-^ΔΔCT method based on the Ct values obtained via quantitative PCR.

Wound healing assay

Cells were seeded into 6-well plates at a density of 1 × 10⁶ cells per well. After transfection and overnight incubation, a linear wound was created across the confluent monolayer using a 10-µL micropipette tip. Images were captured at the start of the experiment (0 h) and after 24 h under 5 × magnification.

Statistical analysis

Statistical comparisons between two groups were conducted using Student’s t-test. Differences among multiple groups were evaluated with the Wilcoxon rank-sum and Kruskal-Wallis tests. Cancer outcomes were analyzed using the log-rank test and Cox regression analysis. Statistical significance was defined as P < 0.05.

SHROOM2 was highly expressed in pan-cancer

Analysis of RNA-seq data from TCGA and GTEx repositories revealed significant overexpression of SHROOM2 in cancers such as adenoid cystic carcinoma (ACC), bladder urothelian carcinoma (BLCA), cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), colon adenocarcinoma (COAD), colon adenocarcinoma/rectum adenocarcinoma (COADREAD), esophageal carcinoma (ESCA), gliobastoma multiforme (GBM), lower-grade glimas (GBMLGG), kidney chromophobe (KICH), acute myeloid leukemia (LAML), brain lower grade glioma (LGG), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), ovarian carcinoma (OV), pancreatic adenocarcinoma (PAAD), prostate adenocarcinoma (PRAD), skin cutaneous melanoma (SKCM), stomach adenocarcinoma (STAD), stomach and esophageal carcinoma (STES), testicular germ cell tumors (TGCT), thyroid carcinoma (THCA), and uterine carcinosarcoma (UCS) (Figs. 1A–1B). In BC, SHROOM2 expression was significantly higher in tumor samples compared to healthy breast tissue (Fig. 1C).

SHROOM2 was correlated with prognosis in pan-cancer

SHROOM2 levels correlated with OS in BRCA, kidney renal clear cell carcinoma (KIRC), and rectum adenocarcinoma (READ) (Fig. 2A); DSS in KIRC and sarcoma (SARC) (Fig. 2B); and PFI in KIRC, PAAD, SARC, THCA, and uveal melanoma (UVM) (Fig. 2C). Kaplan–Meier curves were generated to illustrate the relationship between SHROOM2 levels and prognosis in different cancers (Figs. 2D–2M).

Additionally, SHROOM2 expression was associated with several clinicopathological features. Higher levels were observed in patients aged ≤60 years (Fig. 3A), those with positive estrogen receptor (ER) status (Fig. 3B), progesterone receptor (PR) status (Fig. 3C), and luminal A and luminal B subtypes (Fig. 3D). SHROOM2 also exhibited high diagnostic accuracy, with an area under the curve (AUC) of 0.775 (Fig. 3E).

Subgroup analysis was conducted to assess the impact of SHROOM2 on survival outcomes in BC patients with varying clinicopathological features (Figs. 3F–3O). The results revealed a significant association between SHROOM2 expression and poorer survival in ER-positive (Fig. 3H), PR-positive (Fig. 3J), and luminal A BC (Fig. 3L) groups, suggesting a strong correlation between these traits and SHROOM2 levels.

SHROOM2 was correlated with multiple cancer-related signaling pathways

Pathway analysis was performed to explore the role of SHROOM2 in cancer-related mechanisms. Pan-cancer GSEA identified SHROOM2 enrichment in several cancer-associated pathways, including EMT (Fig. 4A). In BC, GSEA demonstrated SHROOM2’s association with DNA methylation, N-cadherin, and estrogen signaling pathways (Fig. 4B).

SHROOM2 affected immunomodulators, immune checkpoints, ICI, immune activity, and TMB in pan-cancer

Spearman correlation analysis revealed a strong association between SHROOM2 expression and that of immunomodulators in pan-cancer (Fig. 5).

Additionally, SHROOM2 levels were found to correlate with immune checkpoint expression across various cancer types (Fig. 6A). Notably, SHROOM2 expression was positively correlated with PD-L1 (CD274) in BRCA, CESC, COAD, COADREAD, GBM, KICH, kidney renal papillary cell carcinoma (KIRP), LGG, LIHC, LUSC, PRAD, SARC, STES, TGCT, thymoma (THYM), and Wilms tumor (WT) (Fig. 6A).

As illustrated in Fig. 6B, SHROOM2 expression was strongly associated with inflammation-related pathways in multiple cancer types.

Furthermore, as shown in Fig. 7, SHROOM2 levels were linked to the presence of various immune cell types across pan-cancer. In BC, SHROOM2 levels were correlated with immune, stromal, and ESTIMATE scores (Fig. 8A). The distribution of immune cell types in BC samples is presented in Fig. 8B. Notably, SHROOM2 expression was associated with the infiltration of B cells, CD4+ T cells, CD8+ T cells, cancer-associated fibroblasts, macrophages, neutrophils, and mast cells in BC (Fig. 8C). In addition, immune activity scores were significantly higher in the low-SHROOM2-expression cohort compared to the high-SHROOM2-expression cohort (Fig. 8D).

Analysis of the relationship between SHROOM2 expression and TMB (Figs. 9A–9K) indicated a positive correlation between SHROOM2 levels and TMB in LAML (Fig. 9F) and THYM (Fig. 9J), while a negative correlation was observed in COAD (Fig. 9A), ESCA (Fig. 9B), HNSC (Fig. 9C), KIRC (Fig. 9D), KIRP (Fig. 9E), LIHC (Fig. 9G), LUAD (Fig. 9H), STAD (Fig. 9I), and UCEC (Fig. 9K).

SHROOM2 expression was associated with drug sensitivity in BC

The relationship between SHROOM2 expression and clinical response to anti-cancer treatments was assessed by examining its correlation with various common anti-cancer agents (Figs. 10A–10H). The data revealed that increasing SHROOM2 expression was associated with elevated IC₅₀ values for standard chemotherapeutic agents, including docetaxel (Fig. 10A), paclitaxel (Fig. 10B), doxorubicin (Fig. 10C), cisplatin (Fig. 10D), 5-Fluorouracil (Fig. 10E), and methotrexate (Fig. 10F) (Figs. 10A–10F). In contrast, SHROOM2 expression did not significantly influence the efficacy of targeted or endocrine therapies (Figs. 10G–10H). These results suggest that SHROOM2 expression modulates the sensitivity of BC cells to chemotherapeutic agents.

SHROOM2 induced breast cancer cell proliferation, migration, and invasion in vitro

In vitro experiments were conducted to evaluate the impact of SHROOM2 expression on the biological behavior of BC cells. As demonstrated in Figs. 11A–11B, SHROOM2 expression was successfully silenced in MCF7 and MDA-MB-231 BC cell lines via siRNA transfection. CCK-8 assays showed that SHROOM2 knockdown significantly reduced the proliferation rate of both cell lines (Figs. 11C–11D).

Transwell assays further confirmed that silencing SHROOM2 impaired the migratory and invasive abilities of both BC cell lines (Figs. 12A–12B). Consistent with these findings, wound healing assays indicated a reduction in cell migration following SHROOM2 knockdown (Figs. 12C–12D).