CDCP1 knockdown suppresses PDGFRβ/AKT pathway-mediated vascular smooth muscle cell proliferation by inhibiting PDGFRβ endocytosis

Murine focal carotid stenosis model

Animal experiments conformed to the guidelines issued by the Ethics Committee of Guangdong Medical Experimental Animal Center. Approval for this study was granted by the Ethics Committee at the Guangdong Medical Experimental Animal Center (ethical number: D202403-51). Twelve male C57BL/6 mice, 8 weeks, were randomly allocated into two equal groups and subjected to a focal carotid stenosis model, as previously described (Kumar & Lindner, 1997; Mukai et al., 2006; Tao et al., 2013). The mice were housed in SPF-grade animal facilities in the Comparative Medical Laboratory of the Guangdong Medical Experimental Animal Center, with three mice per cage, maintaining a controlled room temperature (24–25 °C), with a 12-h light/dark cycle. Standard feed and water were provided to ensure the health and comfort of the mice. After the administration of a 1% pentobarbital sodium via intraperitoneal injection to anesthetize mice, the left common carotid artery was isolated and ligated at the point of the left internal and external carotid arteries. The right common carotid artery was used as the sham group, only separated and not ligated. At 7, 14, 21, and 28 days postoperatively, overdose of 1% pentobarbital sodium by intraperitoneal injection was used for euthanasia of all mice. The bilateral common carotid arteries were obtained and slices were prepared for subsequent experiments.

Histological and morphological analysis

For the histological analysis, the collected arteries were fixed and embedded in paraffin and subsequently sectioned into five µm sections for hematoxylin-eosin staining (Cat. no. G1076; Servicebio, Wuhan, China). First, stain with hematoxylin for 2 min, then differentiate. After differentiation, stain with eosin staining solution for 30 s, followed by another differentiation step. Finally, proceed with dehydration and clearing. The measurements of the lumen area, intimal area, and medial area were conducted utilizing ImageJ software.

Cell culture

VSMCs derived from mice were obtained from Fenghuishengwu Inc. (cat#CL0710; Wuhan, China), cultured in DMEM (cat#C3120-0500; VivaCell, Yerevan, Armenia) supplemented with 10% FBS (cat#164210; Pricella, Houston, TX, USA) and 1% penicillin streptomycin (cat#03-031-1BCS; Boehringer Ingelheim, Ingelheim am Rhein, Germany), and kept at 37 °C in 5% CO₂.

siRNA synthesis and transfection

siRNA oligonucleotides targeting the mouse CDCP1 gene (siCDCP1) were designed. Using a random sequence as a negative control. A riboFECT-TM CP Transfection Kit (Cat. no. C10511-05; RiboBio, Guangzhou, China) was used to transfect siCDCP1 (CAGAAGCTACAGCAGCATA) into mouse VSMCs. Briefly, 50 pmol siCDCP1 with 1 X buffer and 12 µL reagent were combined for 15 min and cultured alongside VSMCs for 24 h at 37 °C with 5% CO₂. The interval between transfection and subsequent experiments was 24 h.

qRT-PCR

RNA was isolated from VSMCs using the CELL RNA kit (Cat. no. 19231ES50; YEASEN, Shanghai, China). RNA quality was assessed by a microplate reader (Invitrogen, Waltham, MA, USA). Using a cDNA reverse transcription kit (Cat. no. R323; Vazyme, Nanjing, China), 1,500 ng of RNA was reverse transcribed into cDNA in accordance with the guidelines outlined in the kit manual. We then performed quantitative real-time PCR for validation. The PCR amplification protocol was as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 25 s. Finally, an extension step at 72 °C for 10 min was performed. The primer sequences used were as follows: Cdcp1: Forward: TCTCTCGGTATGGCTGGTCA, Reverse: ACGGTCTCCTTCGAGTACCA; β-actin: Forward: GTTGCTATCCAGGCTGTGCT, Reverse: GAGGGCATACCCCTCGTAGA.

CCK8 assay

We measured cell activity with CCK8 to determine the activity in VSMCs. VSMCs were first plated into a 96-well plate, followed by VSMCs transfected with CDCP1 siRNA. VSMCs were stimulated with PDGF-BB (20 ng/mL) (Cat. no. 50611; Cell Signaling Technology, MA, USA) for another 24 h. Subsequently, CCK8 solution (Cat. no. C0037; Shanghai, China) was introduced into each well and subsequently incubated in a cell incubator for a duration of 2 h. The final results were then quantified using a microplate reader (Cat. no. 1900; Shanpu, Shanghai, China) at a wavelength of 450 nm.

Cell proliferation assay

The proliferation of VSMCs was assessed using an EDU Cell Proliferation Kit (Cat. no. C0075S; Beyotime Biotechnology, Haimen, China). After the transfection process, EDU was added to the cells and incubated for 2 h, following the manufacturer’s instructions. During each EDU assay, five random fields were analyzed under a microscope. The percentage of positive cells was calculated by dividing the number of EDU-positive cells by the total cell count in each field.

The wound-healing assay

The wound-healing assay was employed to evaluate the migration of cells. VSMCs were placed into new culture dishes and transfected with CDCP1 siRNA. After complete cell fusion, we created a two mm scratch in the cell, washed it twice with PBS, replaced it with low-serum culture medium with fetal bovine serum (containing 1% FBS), and added PDGF-BB (20 ng/mL) to it. We then collected images under the microscope 24 h later and calculated the damage repair area of each group of cells.

Transwell assay

A cell migration assay was conducted using an eight µm transwell plate (Cat. no. 3422; Corning, NY, USA). Cells were seeded in the upper chamber of the transwell plate at a density of 5 × 10$\stackrel{ˆ}{}$3 cells per well. The lower chamber was filled with 500 µL of culture medium containing 10% FBS. The cells were then incubated for another 24 h. Migrated cells were stained with 1% crystal violet (Cat. no. G1062; Solarbio, Beijing, China) and photographed under a microscope.

RNA-sequencing

RNA was isolated from VSMCs using the CELL RNA kit (Cat. no. 19231ES50; YEASEN, Shanghai, China). RNA quality was assessed by a microplate reader (Invitrogen, Waltham, MA, USA). RNA sequencing were performed between the control siRNA and CDCP1 siRNA group. Differential expression analysis after CDCP1 knockdown was performed using the DESeq2 R package (1.20.0). Differentially expressed genes (DEGs) with —log 2FC— > 1 and Padj < 0.05 were recognized as genes that are significantly expressed differently. A total of 123 DEGs were identified and cluster analysis was then performed. The enrichment analysis of differential genes through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) can elucidate the functional enrichment of DEGs and delineate distinctions at the level of gene functionality. In this study, we employed the clusterProfiler package in R to conduct both GO functional enrichment and KEGG pathway enrichment analyses. The statistical power associated with this experimental design, as determined by RNASeqPower, is 0.96. A P-value of less than 0.05 was deemed indicative of significant enrichment in the GO or KEGG pathways.

Western blot

Harvested cells were lysed using RIPA Lysis Buffer (Cat. no. R0010; Solarbio, Beijing, China). Protein extracts (30 µg of total protein/sample) were electrophoresed using 10% SDS-PAGE (Cat. no. MA0387; Meilunbio, Dalian, China) and moved onto PVDF membranes (Cat. no. 03010040001; Sigma, Burlington, MA, USA). The membranes that were blotted underwent a blocking procedure using 5% non-fat milk for a duration of 1 h. Following this, they were incubated at 4 °C overnight with primary antibodies targeting CDCP1 (Cat. no. 12754-1-AP; Proteintech, Wuhan, China), Rab5 (Cat. no. 46449; Cell Signaling Technology, Danvers, MA, USA), PDGFRβ (Cat. no. ET1605-20; Huaan, Hangzhou, China), AKT (Cat. no. ET1609-51; Huaan, Hangzhou, China), p-PDGFRβ (Cat. no. 3166; Cell Signaling Technology, Danvers, MA, USA) and P-AKT (Cat. no. AF0016; Affinity Biosciences, Cincinnati, OH, USA). The membranes underwent an additional incubation with secondary antibodies conjugated to horseradish peroxidase for a duration of 1 h. Subsequently, the signals were visualized employing an electrochemical luminescence (ECL) reagent. Images were acquired using a chemiluminescence imaging system JP-K600 (Jiapeng, Guangdong, China).

Co-immunoprecipitation

For co-immunoprecipitation (Co-IP), cell lysis was performed using protein lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1.0% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS) supplemented with a comprehensive proteinase inhibitor (Cat. no. P0100; Solarbio, Beijing, China) according to the manufacturer’s instructions. Antibodies against PDGFRβ (Cat. no. ET1605-20; Huaan, Hangzhou, China) were added to the lysates with protein A/G beads (Cat. no. sc-2003; Santa Cruz, CA, USA) and kept overnight at 4 °C. After centrifugation, the precipitate was collected and cleaned three times. After resuspending the mixture with 2X loading buffer, we heated at 95 °C for 5 min. The compounds were re-centrifuged and the supernatant was used for western blotting.

For the ubiquitination experiment, cells were lysed, and PDGFRβ antibody (Cat. no. ET1605-20; Huaan, Hangzhou, China) along with protein A/G beads (Cat. no. sc-2003; Santa Cruz, CA, USA) were mixed with the lysate for overnight incubation at 4 °C. The following day, the bound proteins were analyzed using western blotting with a ubiquitination antibody (Cat. no. sc-8017; Santa Cruz, CA, USA).

Immunofluorescence

Paraffin-embedded five µm sectioned common carotid arteries were incubated with CDCP1 antibody (Cat. no. EM1701-84; Huaan, Hangzhou, China). Mouse VSMCs were cultured on confocal dishes for 24 h. For immunofluorescence staining, the cells were subjected to fixation and permeabilization utilizing a solution of 0.1% Triton X-100 (Cat. no. G1076; Solarbio, Beijing, China) at room temperature for 30 min, and exposed to PDGFRβ (Cat. no. ab69506; Abcam, Cambridge, UK), NEDD4 (Cat. no. 2740; Cell Signaling Technology, Danvers, MA, USA), clathrin (Cat. no. 4796; Cell Signaling Technology, Danvers, MA, USA), Rab5 antibodies (Cat. no. 3547; Cell Signaling Technology, Danvers, MA, USA) at 4 °C overnight. The cells were treated with Alexa Fluor@555 conjugated Goat Anti-mouse IgG (Catalog number 1030-32; SouthernBiotech, Birmingham, AL, USA) and Alexa Fluor@488 conjugated Goat Anti-rabbit IgG (Catalog number 4030-30; SouthernBiotech, Birmingham, AL, USA) at room temperature for a duration of 1 h, protected from light. Finally, nuclei were additionally stained with DAPI (Cat. no. 0100-20; SouthernBiotech, AL, USA). Pictures were obtained utilizing a fluorescence microscope (BZ-X810, KEYENCE) at 600x magnification.

Statistical analysis

All statistical analyses were conducted employing Prism 9.0 software. To assess the significance between the two groups, an unpaired Student’s t-test was utilized, while one-way analysis of variance, succeeded by Tukey’s test, was implemented to determine differences across multiple groups. The results are expressed as mean ± standard deviation. A P-value of less than 0.05 was deemed statistically significant.

Increased CDCP1 expression in intimal hyperplasia in vivo

To identify whether CDCP1 participated in intimal hyperplasia, we ligated the bifurcation of the internal and external carotid arteries in mice. Sections of the common carotid artery obtained at 7, 14, 21, and 28 days were taken separately after ligation, and hematoxylin and eosin (HE) staining was used to examine intimal hyperplasia in mice. Intimal hyperplasia gradually increased with prolonged ligation times in mice, and after 21 days of ligation, the blood vessels were completely blocked (Fig. 1A). We measured the vascular lumen area, intimal area, and medial area and calculated the intimal/medial ratio at each time point separately. The lumen area gradually decreased (Fig. 1B), while the intimal and medial area gradually increased (Figs. 1C and 1D), and the intimal/medial thickness ratio also gradually increased (Fig. 1E). Additionally, immunofluorescence staining of the ligated carotid artery showed that the expression levels of CDCP1 were markedly elevated in comparison to the sham group, and positively correlated with the degree of intimal hyperplasia (Figs. 1F and 1G). Morever, the result of the western blot was consistent with those of the IF analysis. With the extension of the ligation days, the expression of CDCP1 increased and reached its highest level in the tissue after 21 days of ligation (Figs. 1H and 1I).

CDCP1 knockdown inhibited VSMCs proliferation and migration triggered by PDGF-BB

Since arterial blood vessels are primarily composed of smooth muscle cells, endothelial cells, and fibroblasts, macrophages are involved when inflammation occurs. We selected four different types of cells (VSMCs, ECs, fibroblasts, macrophages) to detect CDCP1 expression, and found VSMCs had the highest expression of CDCP1 (Figs. 2A and 2B). Next, we stimulated VSMCs using PDGF-BB (20 ng/mL) for 24 h, and discovered CDCP1 level was significantly upregulated (Figs. 2C and 2D). These results proved CDCP1 was involved in cell proliferation in VSMCs.

To further understand the role of CDCP1 within cellular contexts, CDCP1 siRNA was implemented to transfect VSMCs, qRT-PCR was leveraged to assess the knockdown efficiency of CDCP1, and the results showed that CDCP1 expression was significantly knocked down (Fig. 2E). Abnormal proliferation and migration of VSMCs are major contributors to intimal hyperplasia. Therefore, we continue to investigate the effects of CDCP1 knockdown on the proliferation and migration of VSMCs. CCK-8 and EDU assays were utilized to evaluate cell viability after CDCP1 knockdown, showing that CDCP1 knockdown significantly inhibited cell viability (Fig. 2F) and EDU⁺ cells (Figs. 2G and 2H) under PDGF-BB stimulation. The Transwell and wound healing assays were performed to confirm CDCP1’s effect on cell migration, and we found CDCP1 knockdown inhibited cell migration (Figs. 2I and 2J, Fig. S2). Similarly, PCNA expression was decreased under PDGF-BB stimulation after CDCP1 knockdown (Figs. 2K and 2L). These results indicated that knocking down CDCP1 inhibited cell proliferation and migration in VSMCs.

RNA-Seq analysis of CDCP1 knockdown in mouse VSMCs

We confirmed CDCP1 was involved in cell proliferation and migration; however, its regulatory mechanism remained unclear. To this end, CDCP1 was knocked down in mouse VSMCs for RNA sequencing. A total of 123 differential genes were identified based on RNA sequencing, in which 25 genes exhibited upregulation and 98 genes exhibited downregulation (Fig. 3A). These DEGs were then studied for GO enrichment and KEGG pathway enrichment. GO enrichment analysis revealed CDCP1’s function on “negative regulation of cellular response” and “protein phosphatase binding” (Fig. 3B). KEGG enrichment analysis indicated CDCP1’s function on “PI3K-AKT signaling pathway”, “ubiquitin mediated proteolysis”, “endocytosis”, and “MAPK signaling pathway” (Fig. 3C).

CDCP1 knockdown inhibited PDGFRβ/AKT signaling in VSMCs induced by PDGF-BB

The AKT signaling pathway plays a critical role in regulating the proliferation of smooth muscle cells. Activation of the AKT pathway can lead to increased cell proliferation. To assess the role of CDCP1 in regulating AKT signaling, mouse VSMCs transfected with CDCP1 siRNA were serum-starved for 12 h and afterward exposed to PDGF-BB for 5, 15, and 30 min, after which PDGFRβ phosphorylation and downstream AKT signaling were determined by western blot (Figs. 3D–3G). The results suggested that CDCP1 expression was significantly decreased with CDCP1 siRNA treatment (Fig. 3E). Phosphorylated PDGFRβ (Fig. 3F) and AKT (Fig. 3G) levels also decreased with PDGF-BB (20 ng/mL) stimulation for 30 min after CDCP1 knockdown. Moreover, we also examined the effect of CDCP1 knockdown on the ERK pathway. With the prolonged stimulation of PDGF-BB, the phosphorylation level of ERK gradually increased. However, knockdown of CDCP1 significantly inhibited the activation of ERK phosphorylation (Fig. S1). These results indicate that knocking down CDCP1 inhibits the PDGFRβ/AKT signaling pathway and the ERK signaling pathway.

CDCP1 knockdown increased NEDD4-mediated PDGFRβ ubiquitination

RNA-seq analysis revealed CDCP1’s function in ubiquitin mediated proteolysis (Fig. 3C). To assess whether CDCP1 knockdown had an impact on the ubiquitination of PDGFRβ, we conducted immunoprecipitation experiments to detect changes in the PDGFRβ ubiquitination level after CDCP1 knockdown in VSMCs. The findings indicated that the reduction of CDCP1 expression markedly elevated the ubiquitination rate of PDGFRβ under the condition of PDGF-BB stimulation (Fig. 4A). NEDD4 is a ubiquitinase that serves a key function in governing cellular processes including protein degradation, membrane trafficking, and cell signaling (Yang et al., 2020). Therefore, we examined whether CDCP1 knockdown affected the expression of NEDD4 and the binding of PDGFRβ to NEDD4. Co-IP results demonstrated CDCP1 knockdown increased the association of PDGFRβ with NEDD4 under PDGF-BB stimulation (Figs. 4B and 4C). However, the relationship of PDGFRβ and NEDD4 was not affected in the absence of PDGF-BB stimulation (Figs. 4B and 4C). Therefore, we conducted immunofluorescence (IF) assay to further explore the binding of PDGFRβ and NEDD4 under PDGF-BB stimulation. The results also showed CDCP1 knockdown enhanced the co-localization of PDGFRβ and NEDD4 (Figs. 4D and 4E). This result further corroborates the impact of CDCP1 on protein ubiquitination as indicated by the RNA-Seq analysis and explains the experimental findings that CDCP1 knockdown inhibits the activation of the PDGFRβ/AKT signaling pathway.

CDCP1 knockdown inhibited clathrin-mediated PDGFRβ endocytosis

PDGFRβ is primarily expressed on the cell membrane. Upon stimulation with PDGF-BB, PDGFRβ is internalized into the cell, where it undergoes subsequent processes such as signaling pathway activation or degradation. Under PDGF-BB stimulation, PDGFRβ was internalized into cells mediated by clathrin (Kim et al., 2020). Clathrin-dependent endocytosis enhances signaling and responses (Chen et al., 2009). To investigate how CDCP1 exerts its functions in VSMCs stimulated by PDGF-BB, Co-IP, and IF assays were conducted to verify the interaction between CDCP1 with clathrin. The Co-IP results indicated CDCP1 knockdown attenuated the co-localization of PDGFRβ and clathrin under PDGF-BB stimulation (Figs. 5A and 5B). In order to provide additional confirmation regarding the impact of CDCP1 knockdown on the interaction between PDGFRβ and clathrin under PDGF-BB stimulation, we used IF to locate PDGFRβ (red) and clathrin (green) in VSMCs stimulated by PDGF-BB and found that CDCP1 knockdown decreased the interaction of clathrin and PDGFRβ (Figs. 5D and 5E).

After PDGFRβ coated by clathrin internalized in the cell, clathrin is hydrolyzed and replaced by Rab5 to transport PDGFRβ and mediate its intracellular functions (Hyttinen et al., 2013). The result of Co-IP assay showed that the relationship of PDGFRβ and Rab5 was inhibited under PDGF-BB stimulation (Figs. 5A and 5C). Furthermore, IF assay also demonstrated that PDGFRβ (green) interacted with Rab5 (red), and CDCP1 knockdown reduced the relationship between Rab5 and PDGFRβ under PDGF-BB treatment (Figs. 5F and 5G). These results suggest CDCP1 knockdown leads to reduced PDGFRβ endocytosis, which may inhibit the PDGFRβ signaling pathway.