Long-term passage impacts human dental pulp stem cell activities and cell response to drug addition in vitro

Cell culture and treatments

The manuscript of this laboratory study has been written according to Preferred Reporting Items for Laboratory studies in Endodontology (PRILE) 2021 guidelines. Human dental pulp stem cells (DPSCs; Lonza, PT-5025) were implemented in this study because their lineage and species origin present a practical in vitro system for studies. They are commercially available primary cell line that can be used in follow-up and confirmatory experiments by our research team as well as other investigators (Irfan et al., 2022). According to the company’s data, DPSCs are tested for CD105⁺, CD166⁺, CD29⁺, CD90⁺, CD73⁺, CD133⁻, CD34⁻, CD45⁻ using flow cytometry. Cells were continuously passaged until reaching passage 16. Cell passage 4–6, 9–11, and 14–16 were used in the experiments and these passages were referred to as P5 (early passage), P10 (extended passage), and P15 (late passage), respectively. DPSCs were maintained in standard culture media, which were Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplement with 10% fetal bovine serum and 1% penicillin/streptomycin at 37 °C and 5% CO₂ humidified atmosphere. DPSCs were plated at the density of 7,500 cells/cm²  and then treated with ALN at various concentrations (0, 0.1, 0.5, 5, 10 µM). In this study, 0.1–0.5 µM ALN was considered low concentration and 5–10 µM ALN was moderate concentration. For cell differentiation, DPSCs were cultured under osteogenic media (OM), which were standard culture media supplemented with 50 µg/ml ascorbic acid (BDH), 10 mM β-glycerophosphate (Sigma-Aldrich, St. Louis, MO, USA), and 100 nM dexamethasone.

Cell adhesion assay

Cells were seeded and treated with ALN for 5 h. Although cells can attach to the plate within minutes after cell seeding, DPSCs were incubated for longer periods to let the cells adequately contact the substrate. Thus, the cells had stronger adhesion strength and had enough numbers of cells to perform the assays and analysis. Non-adherent cells were removed by gently washing with phosphate-buffered saline solution. Adherent cells were fixed with 4% paraformaldehyde for 15 min at room temperature. Cells were stained with 1% crystal violet (Reag. Ph. Eur.) for 20 min and rinsed carefully. Cells were examined under a microscope (Nikon Eclipse Ti, Nikon Instruments) at 100x magnification. Ninety-six images of cells from four wells were captured using NIS element AR 4.11.00 software. The numbers of cells ranged from 190-2084 were recorded and analyzed.

Cell and nuclear morphological assay

Cells were treated with ALN for 3 days. Cells were fixed with 4% paraformaldehyde for 15 min and incubated with 1% crystal violet for 20 min. Cell appearance was monitored at 100x magnification. Forty areas from four wells were recorded and 410–600 cells were analyzed. Nuclear shape was stained with 4′,6-diamidino-2-phenylindole (DAPI) at the dilution 1:1000 for 5 min. Nuclei were visualized under a confocal microscope (Nikon Eclipse Ti, Nikon Instruments) at 200x magnification. The numbers of nuclei ranged from 447–675 were examined.

Image analysis

Quantitative data was analyzed by ImageJ software version 1.53k Java 1.8.0 (National Institute of Health). Images of cells stained with crystal violet were assessed according to previous report (Patntirapong, Charoensukpatana & Thaksinawong, 2022). In brief, the scale was set in a micrometer unit. Original images were processed by automated detection mode. The background of images was eliminated using the Subtract Background function. Images were converted to 8-bit grayscale and were processed by Auto Threshold commands. Cluster cells were optionally segmented by Watershed function. Cells were identified and analyzed by Analyze Particles function. Data from isolated cells were collected. In the cell morphological test, the particles smaller than 200 µm² were excluded and identified as debris. For nuclear analysis, images of the nuclei were processed as described in previous report (Patntirapong et al., 2021a). Quantitative data such as area (µm²), perimeter (µm), roundness, aspect ratio (AR), circularity, solidity, and number were measured.

Cell proliferation assay

DPSCs treated for 1, 3, and 7 days were incubated with 10 µL of the CCK-8 solution (Dojindo Laboratories) at 37 °C for 3 h according to company instruction. The plates were analyzed using a microplate reader (Sunrise) with Megellan software, V6.6 at the absorbance 450 nm.

Protein measurement and alkaline phosphatase (ALP) activity

Cells were cultured in OM and treated with ALN for 7 days. Media were collected for measuring ALP released in the media. Cells were lysed with Triton X-100 lysis buffer (50 mM Tris, 150 mM NaCl, and 1% Triton X-100, pH 10). Cell lysates were measured for total proteins using the BCA protein assay kit (Pierce). The mixture was read at absorbance 562 nm using a microplate reader. Total protein was quantified against known BCA protein concentration. The aliquots with an equal amount of protein content from each sample and media were incubated with ALP substrate using ALP assay kit (Elabscience) at 37 °C for 15 min. The optical density of p-nitrophenol was determined by a spectrophotometer at 520 nm. ALP activity was calculated relative to standard phenol solution and expressed as ng/ml.

Real-time polymerase chain reaction (PCR)

mRNA was isolated from OM-induced cells using the Total RNA Mini kit (Geneaid). All purified mRNA samples were processed into cDNA using oligo dT (TAKARA BIO INC.). cDNA samples were amplified in a reaction mix containing KAPA SYBR® FAST PCR Kit Master Mix (Thermo Fisher Scientific, Waltham, MA, USA)) and the forward and reverse primer pair sequences (Sigma-Aldrich, St. Louis, MO, USA). The amplification was run in QuantStudio™ 3 Real-Time PCR Systems (Thermo Fisher Scientific). The cycles were set at 50 °C for 2 min initial heating, 95 °C for 1 min, 40 cycles of 95 °C for 30 s, followed by 60 °C for 30 s with 72 °C elongation for 30 s. The forward/reverse primer pairs were as follows: glyceraldehyde 3-phosphate dehydrogenase (GAPDH) “CTCATTTCCTGGTATGACACC” and “CTTCCTCCTGTGCTCTTGCT”; collagen type I (Col I) “TGACCTCAAGATGTGCCACT” and “ACCAGACATGCCTCTTGTCC”; osteocalcin (OC) “TCACACTCCTCGCCCTATTG” and “TCGCTGCCCTCCTGCTTG”; Bone sialoprotein (BSP) “AACCTACAACCCCACCACAA” and “AGGTTCCCCGTTCTCACTTT”; dentin sialophosphoprotein (DSPP) “AGACGAGGGTTCTGGTGATG” and “TCTTCTTTCCCATGGTCCTG”; dentin matrix acidic phosphoprotein 1 (DMP1) “GCAGAGTGATGACCCAGAG” and “GCTCGCTTCTGTCATCTTCC”. The gene copy number was normalized with GAPDH. Data were presented in fold changes relative to control of each group.

Statistical analysis

Four independent experiments were performed. Data was tested for normal distribution using the Kolmogorov–Smirnov test (GraphPad Prism 9.4.0). Data that was normally distributed was analyzed by ANOVA followed by Dunnett’s test. Data that was not normally distributed was analyzed by Kruskal-Wallis test followed by Dunn’s procedure. Significance was assigned as * p < 0.05, ** p < 0.01, *** p < 0.001 vs P5 in the same ALN treatment group; ^a p < 0.05, ^aa p < 0.01, ^aaa p < 0.001 vs P5A0 in P5 group; ^b p < 0.05, ^bb p < 0.01, ^bbb p < 0.001 vs P10A0 in P10 group; ^c p < 0.05, ^cc p < 0.01, ^ccc p < 0.001 vs P15A0 in P15 group.

Alteration of cell morphology in early, extended, and late passages under ALN-free and ALN conditions

Microscopic images of DPSCs at P5, P10, and P15 are depicted in Figs. 1A, 1B, and 1C, respectively. Cells in each condition showed different cell size and shape. Untreated DPSCs at P5 were small in size and mainly spindle shape (Fig. 1Ai), which mostly maintained the shape and size as observed in P1 cells (Fig. 1D). Continuous culture led to morphological alteration. P10 and P15 cells gradually spread and appeared as polygonal shape. Cells displayed less homogenous morphologies. DPSCs at P15 noticeably exhibited enlarged cell bodies with extended cellular processes. Fewer cells were observed for P10 and P15 (Figs. 1Bi and 1Ci). The addition of ALN to P5 cells altered the cell shape to fusiform (Fig. 1Aiv) or polygonal with more cellular processes (Fig. 1Av). However, cell shrinkage from 10 µM ALN (A10) was observed (Fig. 1Av). The addition of A5 and A10 to P10 and P15 also altered cell shape (Figs. 1B and 1C).

Cell area and perimeter of P10 and P15 were larger than those of P5 in ALN-free and ALN-treated groups (Figs. 2A and 2B). Treatment with A10 increased cell area in every passage (Fig. 2A). In P5, treatment with A0.1-A10 enhanced cell perimeter (Fig. 2B).

Aspect ratio (AR) describes the proportional relationship between the width of a cell and its length. P10 in A0-A0.5 groups had lower AR but P10 in A5-A10 groups showed higher AR compared with P5. P5 treated with A0.5-A10 significantly different from P5A0, whereas P15 treated with A5 notably had higher AR than P15A0 (Fig. 2C). Roundness demonstrated the opposite trend from AR (Fig. 2D).

Circularity is a ratio of area and perimeter. The value of one means that the object has a circular shape. Solidity differentiates the convex and the concave cell area (Hart et al., 2017). Alteration in circularity and solidity implies changes in cell deformability and cell shape (Pasqualato et al., 2013; Hart et al., 2017). P5A0 had the highest values of circularity and solidity (Figs. 2E and 2F). Circularity of most P10 and P15 significantly dropped compared with P5 in their respective treatment groups. P5 cells incubated with ALN at every concentration showed lower circularity than P5A0, whereas P10 and P15 cells treated with ALN at moderate concentrations showed reduction in circularity than P10A0 and P15A0, respectively (Fig. 2E). Solidity showed a similar trend as circularity but in a lesser extent (Fig. 2F).

Alteration of nuclear morphology in early, extended, and late passages under ALN-free and ALN conditions

Nuclei of the cells presented in bright blue color. The shape and size of P5A0 nuclei were homogenous and had oval shape (Fig. 3Ai). Some nuclei of P10A0 and P15A0 appeared larger and less consistent (Figs. 3Bi and 3Ci). Nuclear fragmentation was observed as shown in inset of Fig. 3Ci. ALN treatment caused uneven nuclear shape and size of some nuclei. Nuclear fragmentation was also monitored (arrows) (Fig. 3).

The numbers of nuclei represented the numbers of cells grown on the well plate. P5A0 displayed the highest value of nuclei. P10A0 and P15A0 nuclear numbers drastically declined compared with P5A0, implying slower growth rate in higher passages. The same pattern was seen in all ALN-treated groups except for A10 group. Every ALN concentration reduced the numbers of nuclei in P5 group, while moderate concentrations decreased nuclear numbers in P10 and P15 groups (Fig. 4A).

In every ALN group, nuclear area and perimeter of P5 were smaller than those of P10 and P15. Nuclear area and perimeter of P5 were smaller in response to ALN at lower concentrations, whereas those of P10 and P15 changed at higher concentrations (Figs. 4B and 4C).

AR values opposed to roundness values (Figs. 4D and 4E). In A0-A0.5 groups, P10 and P15 had lower AR but higher roundness, suggesting rounder shape nuclei. On the other hand, AR and roundness of P10 and P15 in A5-A10 groups illustrated less circular shape nuclei compared with P5. DPSCs at P5 and P15 subjected to ALN treatment showed a reduction in AR and an increase in roundness (Figs. 4D and 4E).

In general, circularity and solidity of P15 significantly reduced compared with those of P5 in every ALN group. Circularity and solidity of P15A10 were the lowest value in all condition (Figs. 4F and 4G). These values were related to the irregular shape of some nuclei and nuclear breakage (Fig. 3).

Comparison of cell adhesion in early, extended, and late passages under ALN-free and ALN conditions

Crystal violet-positive cells after 5 h of cell seeding were shown in Fig. 5. The numbers of cell adhesion in P5 were significantly greater than P10 and P15 in untreated and treated groups (Fig. 6A). Cell area and perimeter of P15 were larger than those of P5 in ALN groups. DPSCs responded to ALN treatment by increased cell spreading (Figs. 6B and 6C).

In A0-A0.5 groups, higher passages had lower AR compared with P5. In P5 group, treatment with ALN decreased AR (Fig. 6D). Roundness had the opposite trend from AR (Fig. 6E).

Cell circularity and solidity of P15 significantly decreased compared with those of P5 in every ALN condition. ALN treatment increased circularity and solidity of cells in P5 and P10 (Figs. 6F and 6G).

Reduction of DPSC proliferative capability by replicative passaging and ALN addition

Figure 7 illustrates the proliferative capacity of DPSCs. Without ALN, cells in each passage had normal growth curve from day 1 to day 7. In A0 group, P5 cells maintained the optimal growth rate, whereas P15 had the slowest growth rate in all day tested. Compared with P5, P15 had the reduction rate approximately 50, 65, 70% for 1, 3, and 7 days, respectively (Fig. 7). In ALN treatment groups, the proliferative rate of higher passages gradually reduced from P5. Low concentration of ALN did not affect cell proliferation. A5 and A10 significantly caused a considerable reduction in cell proliferation in every passage compared with their respective passages. Long-term treatment and moderate dose of ALN almost abolished cell proliferation (Fig. 7).

Effects of cell passages and ALN on total protein and ALP activity

The total protein of DPSCs cultured in OM for 7 days was extracted and measured. In general, P5 had higher total protein than P10 and P15 in each ALN group. P10 and P15 significantly had lower total protein compared with P5 in the presence of A5 and A10 (Fig. 8A).

ALP activity was obtained from cell lysate and the release into the media. ALP of P10 significantly dropped compared with that of P5 in A0, A0.1, and A0.5 groups, while ALP of P10 increased compared with that of P5 in A10 groups (Fig. 8B). ALN affected P5 cells by reducing ALP activity in a dose-dependent manner. ALP of P10A5 was enhanced compared with that of P10A0 (Fig. 8B). No significant change was observed in ALP release in the media in all conditions (Fig. 8C).

Effects of cell passages and ALN on gene expressions

Since DPSCs can differentiate into odontoblastic or osteoblastic cells, genes such as Col I, OC, BSP, DSPP, and DMP1 were examined. The data set were presented in 2 aspects: within the same ALN treatment group and within the same passage group. P15 had higher Col I gene expressions than P5 in A0.5, A5, and A10 groups. On the contrary, P15 and P10 had lower OC gene expressions than P5 in A0.5 and A10 groups, respectively. There was no change in BSP, DSPP, and DMP1 genes (Fig. 9A). In P10 and P15, only A10 downregulated Col I gene expressions compared with A0. There was no change in other genes (Fig. 9B).