Clinically, intervertebral disc (IVD) degeneration (IVDD) is commonly seen, and is often associated with lower back pain. It has been demonstrated in previous studies that aberrant apoptosis and accelerated ageing of nucleus pulposus cells (NPCs) are considered as the two major cellular processes which are closely related to IVDD (
In our in-vitro studies, 17β-estradiol (E2) has been found to have a protective effect on rat IVD cells (
Furthermore, E2 (
Therefore, given that E2 has a better anti-apoptotic effect with more cancer risk and RES has an anti-apoptotic effect with less cancer risk, we have built the hypothesis that the combined use of E2 with RES may potentially play a more efficient role in retarding the progress of IVDD-related diseases. The aim of the present study is to explore the combined effect of E2 with RES on cell apoptosis induced by IL-1β in rat NPCs. In the meanwhile, the role of PI3K/Akt pathway in signal transduction has been preliminarily studied.
Animal protocols were approved by the Institutional Animal Care and Use Committee of The Third Hospital of Hebei Medical University. The approval number is K2015-019-1.
The information about reagents and antibodies used in this study was collected in
Reagents/antibodies | Manufacturers | City/country | Catalog no. | Source |
---|---|---|---|---|
FBS | Gibco | New York, US | 10099-141 | Bovine |
Caspase-3 p17 antibody | Santa Cruz | Santa Cruz, CA | sc-98785 | Rabbit |
Akt antibody | Cell signaling | Beverly, MA | 2920 | Mouse |
p-Akt antibody | Cell signaling | Beverly, MA | 12694 | Mouse |
GAPDH | Proteintech | Wuhan, China | 10494-1-AP | Rabbit |
IL-1β | Peprotech | Rocky Hill, NJ | 400-01B | Rat |
Secondary antibodies | Proteintech | Wuhan, China | SA00001 | Goat |
Resveratrol | Sigma-Aldrich | St. Louis, MO | R5010 | Grape skin |
Trypsin | Sigma-Aldrich | St. Louis, MO | T4049 | Porcine |
Collagenase type II | Sigma-Aldrich | St. Louis, MO | C2139 | Rat |
17β-estradiol | Sigma-Aldrich | St. Louis, MO | 491187 | N/A |
DMSO | Solarbio | Beijing, China | D8372-100 | N/A |
DMEM/F12 | Gibco | New York, US | 11320-033 | N/A |
TUNEL detection kit | Promega | Madison, WI | G3250 | N/A |
MTS Reagent Solution | Promega | Madison, WI | G3582 | N/A |
Caspase-3 activity kit | Beyotime | Shanghai, China | C1115 | N/A |
LY294002 | Selleck Chemicals | Huston, TX | S1105 | N/A |
ICI182,780 | Selleck Chemicals | Huston, TX | S1191 | N/A |
PE Annexin V Apoptosis | BD Pharmingen | San Jose, CA | 559763 | N/A |
Detection Kit I |
Cell culture was performed according to our previous report (
FACS analysis was performed according to our previous report (
NPCs were divided into five groups. As a control, group A was treated with vehicle mixture (ethanol and DMSO, <0.1%; ethanol was the solvent of E2 and DMSO was the solvent of RES). Group B was treated with 75 ng/ml IL-1β. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 200 μM RES for 30 min. Group E was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RES for 30 min. All groups were incubated for 24 h in the serum-free medium without phenol red. TUNEL assay was performed to detect apoptosis according to manufacturer’s instructions. Apoptotic changes of NPCs were observed under an inverted fluorescence microscope (Olympus, Japan) and photographed by a digital camera (Nikon, Japan). About 200 cells were counted per sample in the analysis of apoptotic changes of NPCs by the Tunel assay.
Cell viability was determined by MTS assay using CellTiter 96® AQueous MTS Reagent Solution (Promega, Madison, WI, USA) according to manufacturer’s instruction. NPCs were treated in five groups as above and then seeded into 96-well plates. The optical density was measured at 492 nm with a microplate reader (Shimadzu, Kyoto, Japan) and cell viability was normalized as a percentage of control.
Rat NPCs were treated in five groups as described above and then assayed for their ability to bind COL2α1 according to the reported method (
Active caspase-3 activity was performed according to our previous report (
PCR was performed according to our previous report (
No. | Target gene | Sequence (sense, anti-sense, 5′-3′) | Accession no. (GenBank) |
---|---|---|---|
1 | COL2α−1 | ACGCTCAAGTCGCTGAACAA |
|
2 | Aggrecan | TCCAAACCAACCCGACAAT |
|
3 | MMP-3 | ATGATGAACGATGGACAGATGA |
|
4 | MMP-13 | GGCCAGAACTTCCCAACCA |
|
5 | GAPDH | GGAAAGCTGTGGCGTGAT |
|
Western blot was performed according to our previous report (
Statistical analyses were performed using SPSS for Windows, version 18.0 (SPSS Inc., USA). All data are presented as the mean ± SD (standard deviation) of independent experiments performed (n = 6 for each group). If data satisfied criteria for normality and homogeneity of variance, statistical analysis among multiple groups was performed using one-way analysis of variance (ANOVA), accompanied by pairwise comparison using the SNK-q test. If not, statistical analysis was performed using non-parametric rank test.
As shown in
(A) NPCs were plated into 6-well plates at a density of 2 × 105 cells per well and divided into ten groups as presented in the figure. All groups were incubated for 24 h in the serum-free medium without phenol red. Apoptotic cells were detected using an Annexin V-FITC/PI kit (BD Pharmingen, San Jose, CA, USA) according to the manufacturer’s instructions. Apoptotic cells, stained positive for annexin V-FITC, negative for PI, or double positive, were counted. (B) Data are represented as a percentage of the total cell count. Data analysis was determined by one-way analysis of variance (ANOVA) accompanied by pairwise comparison using SNK-q test. *
As shown in
NPCs were divided into five groups. As a control, group A was treated with vehicle mixture (ethanol and DMSO, <0.1%; ethanol was the solvent of E2 and DMSO was the solvent of RSV). Group B was treated with 75 ng/ml IL-1β. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 200 μM RSV for 30 min. Group E was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RSV for 30 min. All groups were incubated for 24 h in the serum-free medium without phenol red. All cells were stained red by PI, and apoptotic cells presented green. (A) Scale bar, 200 μm; (B) Scale bar, 50 μm; NPCs, nucleus pulposus cells; IL-1β, interleukin-1β; E2, 17β-estradiol; RSV, resveratrol; PI, prodium iodide; n = 6.
As shown in
NPCs were treated in five groups as presented in the figure and then seeded into 96-well plates. All groups were incubated for 24 h in the serum-free medium without phenol red. Cell viability was determined by MTS assay using CellTiter 96® AQueous MTS Reagent Solution (Promega, Madison, WI, USA) according to manufacturer’s instruction. The optical density was measured at 492 nm with a microplate reader (Shimadzu, Kyoto, Japan) and cell viability was normalized as a percentage of control. *
NPCs were divided into five groups. As a control, group A was treated with vehicle mixture (ethanol and DMSO, <0.1%; ethanol was the solvent of E2 and DMSO was the solvent of RSV). Group B was treated with 75 ng/ml IL-1β. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 200 μM RSV for 30 min. Group E was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RSV for 30 min. All groups were incubated for 24 h in the serum-free medium without phenol red. *
NPCs were divided into five groups. As a control, group A was treated with vehicle mixture (ethanol and DMSO, <0.1%; ethanol was the solvent of E2 and DMSO was the solvent of RSV). Group B was treated with 75 ng/ml IL-1β. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 200 μM RSV for 30 min. Group E was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RSV for 30 min. All groups were incubated for 24 h in the serum-free medium without phenol red. Caspase-3 activity was determined using a caspase-3 activity kit (Beyotime, Shanghai, China). Caspase-3 activity is expressed as the fold change in enzyme activity over control. *
As shown in
NPCs were divided into five groups. As a control, group A was treated with vehicle mixture (ethanol and DMSO, <0.1%; ethanol was the solvent of E2 and DMSO was the solvent of RSV). Group B was treated with 75 ng/ml IL-1β. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 200 μM RSV for 30 min. Group E was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RSV for 30 min. All groups were incubated for 24 h in the serum-free medium without phenol red. *
As shown in
NPCs were divided into four groups. Group A was treated with 75 ng/ml IL-1β. Group B was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2 and 200 μM RSV for 30 min. Group C was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2, 200 μM RSV, and 1 μM ICI for 30 min. Group D was treated with 75 ng/ml IL-1β with the pretreatment of 1 μM E2, 200 μM RSV and 50 μM LY294002(PI3K/Akt inhibitor). All groups were incubated for 24 h in the serum-free medium without phenol red. *
In the present study, data show that the gene expression levels of MMP-3 and MMP-13 are both increased while the levels of type II collagen and aggrecan are decreased, due to cytotoxic effect of IL-1β. It is notable that the combined use of E2 and RVS has markedly decreased the cytotoxic effect of IL-1β on NPCs, which was presented as the down-regulation of catabolism (the decreased levels of MMP-3 and MMP-13), and the upregulation of anabolism (the increased levels of COL2α1 and aggrecan). Although the single use of E2 or RES can inhibit the catabolism due to cytotoxic effect of IL-1β, obviously, the combined regulation of E2 with RVS is more effective.
As compared to RES, E2 exerts a better effect to reverse the adverse regulation caused by IL-1β, which is indicated by FACS analysis that more apoptotic incidence is decreased. As well, cellular viability and cell binding is restored more in E2 group than those in RES group. Meanwhile, more catabolism due to cytotoxic effect of IL-1β is prohibited by E2 than RES, with more anabolism increased by E2. However, there is no doubt in this study that the combined use of E2 with RES has an advantage over the single use of E2 or RES. Also E2 combined with RES protects rat NPCs against apoptosis, characterized by enhanced biosynthesis of COL2α1 and aggrecan, as well as increased cell viability and binding ability.
It has long been recognized that there is a continuous increase in cell death during human IVDD. Additionally, nutrient supply to the IVD deteriorates during disc degeneration in humans (
It is well-known that estrogen has been closely related to cancer risk, especially breast cancer. Different from E2, as a polyphenolic compound, RVS has anti-inflammatory, antioxidant, neuroprotective properties and acts as a chemopreventive agent (
RVS has beneficial effects on aging, inflammation and metabolism, which are thought to result from activation of the lysine deacetylase, sirtuin 1 (SIRT1), the cAMP pathway, or AMP-activated protein kinase (
To our knowledge, the potential benefit of RES mainly results from its antioxidant effect (
Up to now, no study has reported any differences between men and women in response to the suggested treatment including E2 in combination with RES, to treat IVDD-related diseases. As we know, women are more sensitive to estrogen deficiency. Thus, this treatment may be more effective to women than men. Surely, when seeking for the potential of E2 in combination with RES, we have to face the possible side effects. One of them is always associated with breast cancer caused by much estrogen use. However, RES has been shown to be a potential protective agent against cancer, inflammatory lesions, diabetes mellitus, and cardiovascular abnormalities. (
The obtained results from this study were in vitro results. In order to draw any conclusions about the in vivo situation, animal experiments needs to be performed since results from in vitro models cannot always be compared and/or applied to the in vivo situation. Thus, the results in this study suggest a role in vivo of the investigated combined anti-apoptotic effects via PI3K/Akt/caspase-3 signaling pathway of E2 and RES in IVDD. This research provides a novel insight into the anti-apoptotic effect of E2 combined with RES, potentially leading to a better understanding of clinical therapies based on apoptosis, especially to retard the progress of IVDD.
Raw data and histograms used in the study.
The authors declare that they have no competing interests.
The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers):
1. Institutional Animal Care and Use Committee of The Third Hospital of Hebei Medical University.
2. Animal protocols were approved by the Institutional Animal Care and Use Committee of The Third Hospital of Hebei Medical University. The approval number is K2015-019-1.
The following information was supplied regarding data availability:
All raw data generated in the research have been included in the figures and tables in the manuscript.